an object of a derived class has more than one type

 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Ngày tải lên : 25/10/2012, 09:56
... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...
  • 6
  • 611
  • 0
Features of a .NET Class

Features of a .NET Class

Ngày tải lên : 05/10/2013, 07:20
... in a class that has these properties or events In a class with a property named P, the names get_P and set_P are reserved, and in a class with an event named E, add_E, remove_E, and raise_E are ... setting the AtomicNumber property to the class and its derived classes That way the radioactive atom can change the atomic number to process a decay event, but consumers of the atom class can’t otherwise ... a class derived from EventArgs that contains the required data Listing 7-20 demonstrates how to use a class derived from EventArgs to send data about an event that can be used in the event handler...
  • 38
  • 298
  • 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Ngày tải lên : 16/01/2014, 21:20
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... principle actors among other relevant actors in the processes of participatory approaches Literature Cited Nguyen Duy Can, Le Thanh Duong and Ryuichi Yamada, 2002 A Participatory Research Approach...
  • 8
  • 492
  • 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Ngày tải lên : 23/03/2014, 09:21
... Nilaparvata lugens Lucilia cuprina Anopheles dirus Bombyx mori Manduca sexta Anopheles gambiae Anopheles gambiae Blattella germanica Drosophila melanogaster Manduca sexta Anopheles gambiae Anopheles ... Udomsinprasert R, Pongjaroenkit S, Wongsantichon J, Oakley AJ, Prapanthadara L -A, Wilce MCJ & Ketterman AJ (2005) Identification, characterization and structure of a new Delta class glutathione transferase ... 269, 27876–27884 23 Ranson H, Prapanthadara L -A & Hemingway J (1997) Cloning and characterization of two glutathione S-transferases from a DDT-resistant strain of Anopheles gambiae Biochem J 324,...
  • 11
  • 426
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
An autobiography of a story book pptx

An autobiography of a story book pptx

Ngày tải lên : 22/07/2014, 03:21
... would then be able to lead a more comfortable life Perhaps I can invent cars that are operated by robots or a computer that thinks like a human My parents think highly of my ambition and are very ... understand the answer In class, I always make sure that I perform each science experiment properly When in doubt, I consult my teachers As a scientist, I would be able to invent new things for mankind ... One day a few girls entered the shop They laughed and joked among themselves They were browsing through the books and one of them picked me up She was attracted to me and bought me immediately...
  • 6
  • 385
  • 0
An autobiography of a pen doc

An autobiography of a pen doc

Ngày tải lên : 22/07/2014, 03:21
... skins and then crawled out of the old ones We then turned into large grey, yellow and orange striped caterpillars My next stage was the pupa stage I crawled under a leaf of the plant and spun a pod ... leaf of a milkweed plant After several days we hatched into tiny black and white larvae At this stage we were called tiny caterpillars We moved about the plant and fed on its fleshy green leaves ... dark corner of the drawer hoping that one day she might use me again An autobiography of a butterfly I am a beautiful Monarch butterfly My name is Jolly My mother laid some eggs on the leaf of...
  • 6
  • 440
  • 0
An autobiography of a dancing doll ppsx

An autobiography of a dancing doll ppsx

Ngày tải lên : 22/07/2014, 03:21
... lady came to the store She looked around the place and her eyes felon me She looked at me in admiration She at once bought me I was given as a birthday present to her only daughter Pam I was ... let her friends handle me When Pam was not attending to me, one of her friends picked me up Pam was furious and tried to pull me away form her friend In the tussle they accidentally ripped my pretty ... very happy with my new mistress but the happy time did not last long One day Pam’s friends brought along their own dolls to play at her house They envied me because I looked very attractive Pam...
  • 4
  • 233
  • 0
Báo cáo toán học: "An extension of a criterion for unimodality" pps

Báo cáo toán học: "An extension of a criterion for unimodality" pps

Ngày tải lên : 07/08/2014, 06:22
... 1994 [4] Stanley, R.: Log-concave and unimodal sequences in algebra, combinatorics and geometry Graph theory and its applications: East and West (Jinan, 1986), 500-535, Ann New York Acad Sci., ... so the condition fails Acknowledgements The work presented here was part of a SIMU project at the University of Puerto Rico at Humacao The authors wish to thank Herbert Medina and Ivelisse Rubio ... if a j sequence is log concave then it is unimodal [5] A sufficient condition for log concavity of a polynomial is given by the location of its zeros: if all the zeros of a polynomial are real and...
  • 7
  • 331
  • 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa

An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa

Ngày tải lên : 28/03/2015, 09:26
... learners are able to understand the formal structures and logical meaning of the material they read with an average degree of difficulty and within general and familiar topics, but cannot understand ... and its social situation British discourse analysis was mainly influenced by M .A. K Halliday‘s functional approach to language Halliday‘s framework emphasized the social function of language and ... language (i.e., cultural and 10 ideological meanings) and lower-order forms of language that contribute to patterning the meaning In layman‘s terms reader cannot neglect the role of individual...
  • 66
  • 704
  • 0
Báo cáo sinh học: " In vitro evaluation of a double-stranded selfcomplementary adeno-associated virus type2 vector in bone marrow stromal cells for bone healing" pptx

Báo cáo sinh học: " In vitro evaluation of a double-stranded selfcomplementary adeno-associated virus type2 vector in bone marrow stromal cells for bone healing" pptx

Ngày tải lên : 14/08/2014, 19:22
... various AAV vectors [50-52] have indicated success in allograft integration and bone healing in mice via increased vascularization and remodelling (rAAV-RANKL and rAAV-VEGF) and increased bone ... lentiviral and adenoviral vectors and AAV for transduction of human bone marrow stromal cells was based on the previously published articles in our lab and elsewhere [12,29,32] As for the AAV, an additional ... in regular media One million rat and human bone marrow stromal cells and 293T cells (ATCC, Manassas, VA, USA) were transduced with Ad-BMP-2 or Ad-GFP in serum free media for hours at MOI of 100,...
  • 8
  • 258
  • 0
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx

Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx

Ngày tải lên : 28/03/2014, 23:20
... ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢ The gene mm0632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 (IBA GmbH, Gottingen, Germany), ... archaeons and bacteria such as Thermotoga maritima, P furiosus and A fulgidus [5,28] In addition, homologs were found in close relatives of M mazei, such as Methanosarcina acetivorans and Methanococcus ... of a monofunctional catalase from Methanosarcina barkeri Arch Microbiol 171, 317–323 39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK & Shima S (2000) Protection of Methanosarcina barkeri against...
  • 10
  • 539
  • 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Ngày tải lên : 31/03/2014, 09:20
... such as A (Ala) or D (Asp) Only AaHIT4 and BmKAS, a specific anti-insect toxin, also contained a Tyr residue at this position AaHIT4, the unique anti-insect toxin also has a toxic effect on mammals ... they are equally potent for cardiac and neuronal Na+ channels [39] Pharmacological activity of recombinant BmKIM Injected into larvae, rBmKIM caused a slow, progressive depressant flaccid paralysis ... preparation was completed using a 121-MB Beckman amino acid analyzer An Applied Biosystems 47 6A sequencer was used for automated Edman degradation The phenylthiohydantoin derivatives of the amino acids...
  • 8
  • 473
  • 0
báo cáo hóa học: " “Case files from the University of Florida: When an earache is more than an earache": A case report" potx

báo cáo hóa học: " “Case files from the University of Florida: When an earache is more than an earache": A case report" potx

Ngày tải lên : 21/06/2014, 02:20
... both ears, with bulging tympanic membranes and decreased light reflex The throat was normal The lungs were clear to auscultation bilaterally, and the heart exam was unremarkable He had a soft and ... and protozoa can cause parasitic brain abscesses, but these are rare Clinical presentation Patients with brain abscess may present a myriad of complaints including headache, mental status changes, ... doi:10.1186/1865-1380-4-33 Cite this article as: Desai and Walls: “Case files from the University of Florida: When an earache is more than an earache": A case report International Journal of Emergency Medicine...
  • 5
  • 329
  • 0
Báo cáo hóa học: " Research Article Secrecy Capacity of a Class of Broadcast Channels with an Eavesdropper" potx

Báo cáo hóa học: " Research Article Secrecy Capacity of a Class of Broadcast Channels with an Eavesdropper" potx

Ngày tải lên : 21/06/2014, 22:20
... case, the input and output alphabets of one subchannel are nonintersecting with the input and output alphabets of the other subchannel Moreover, we can use only one of these subchannels at any ... results can be generalized to an arbitrary number of users If we consider the parallel degraded multireceiver wiretap channel with more than two subchannels and an arbitrary number of users, ... secrecy capacity for a special class of parallel multireceiver wiretap channels was studied in [8] In this class of parallel multireceiver wiretap channels [8], each subchannel exhibits a certain...
  • 29
  • 521
  • 0
Báo cáo y học: "Methotrexate therapy associates with reduced prevalence of the metabolic syndrome in rheumatoid arthritis patients over the age of 60- more than just an anti-inflammatory effect? A cross sectional study" pptx

Báo cáo y học: "Methotrexate therapy associates with reduced prevalence of the metabolic syndrome in rheumatoid arthritis patients over the age of 60- more than just an anti-inflammatory effect? A cross sectional study" pptx

Ngày tải lên : 09/08/2014, 14:22
... Descriptive characteristics of study population The study population comprised of 72.9% females (282/387) and had a median age of 63.1 years Patients had a median disease duration of 10 years, and had moderate ... the data and drafted the manuscript VFP acquired, analysed and interpreted the data HJ drafted the manuscript KMD acquired the data GDK made substantial contributions to the conception and design ... Pollare T, Lithell H, Hallgren R: Impaired glucose handling in active rheumatoid arthritis: relationship to peripheral insulin resistance Metabolism 1988, 37:125-130 Zonana-Nacach A, Santana-Sahagun...
  • 10
  • 499
  • 0
Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx

Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx

Ngày tải lên : 11/08/2014, 03:20
... article as: Mathison et al.: Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein Journal of Inflammation ... 11) feG, and its analogues, exhibit a distinctly different mechanism of anti-inflammatory action from Page of 11 corticosteroids and nonsteroidal anti-inflammatory drugs (NSAIDs) NSAIDs and corticosteroids ... have significant anti-inflammatory actions, as shown in animal models of endotoxic shock (Figures &7), allergic and anaphylactic reactions (Figures 4, 6, &9), pancreatic (Figure 10) and spinal...
  • 11
  • 406
  • 0
báo cáo khoa học: " Molecular characterization of a rice mutator-phenotype derived from an incompatible cross-pollination reveals transgenerational mobilization of multiple transposable elements and extensive epigenetic instability" ppt

báo cáo khoa học: " Molecular characterization of a rice mutator-phenotype derived from an incompatible cross-pollination reveals transgenerational mobilization of multiple transposable elements and extensive epigenetic instability" ppt

Ngày tải lên : 12/08/2014, 03:20
... [http://www.biomedcentral.com/content/supplementary/14712229-9-63-S2.doc] 10 Additional file Characterization of variant AFLP and MSAP bands Chromosomal location and functional homology of isolated variant AFLP and MSAP fragments from the mutator phenotype Tong211-LP ... the manuscript XCC and JHZ performed all pollination work and maintained plants CMX and BL designed the study and finalized the manuscript All authors read and approved the final manuscript Additional ... studies have established that the intrinsic DNA methylation patterns in both plants and animals are faithfully maintained and perpetuated by coordinated function of at least two classes of DNA methyltransferases...
  • 12
  • 303
  • 0