an example of a math rich environment in the classroom
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work ... members of SWG are leaders or they play an important role in their own organizations When development agencies arrive in the village, they often contact with these leaders These leaders can organize...
- 8
- 492
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... levels of identity to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the ... enzyme activity In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D-amino acid oxidases [25–27], as indicated by the absorption peak of the purified enzyme at 266 ... changes in the spectrum during the reaction in a coupled enzyme assay of 4-amino-3-hydroxybenzoic acid and the prepared crude extracts The absorption peaks at 263 and 294 nm characteristic of...
- 7
- 613
- 1
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... important for binding to the toxin The change of Val to Phe may result in a better interaction in terms of an increased contact area Changes at CDRs and in clone 61 0A had a synergistic effect on the...
- 11
- 679
- 0
Báo cáo hóa học: " An exploration of job stress and health in the Norwegian police service: a cross sectional study" docx
... and design, acquisition, analysis and interpretation of data and drafting of the manuscript EH was involved in design, interpretation of data, drafting of the manuscript and supervision ØE was ... was involved in conception and design, interpretation of data, drafting of the manuscript and supervision BL was involved in analysis and interpretation of data AMB is the guarantor for this paper ... Human Resources Institute; 1981 Lazare A, Klerman GL, Armor DJ: Oral, obsessive, and hysterical personality patterns An investigation of psychoanalytic concepts by means of factor analysis Arch...
- 9
- 443
- 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa
... structures and logical meaning of the material they read with an average degree of difficulty and within general and familiar topics, but cannot understand the rhetorical and functional meaning of sentences, ... setting goals and creating and initiating a plan of action, as well as reflecting on the degree to which the plan work At another level, it can be about addressing educational practices that go ... together, interacting in a way which is perceived as meaningful and unified by the participants‖ Farhady (2005) believes that the meaning of the text depends both on the meanings of the words and sentences,...
- 66
- 703
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... On the other hand, in the transition from the 500 kDa band to the 670 kDa band, a structural rearrangement of the bc1 complex may occur due to the binding of ISP and Qcr10p, possibly leading ... Molecular characterization of a 500 kDa bc1 sub-complex in the yeast deletion strains lacking Qcr9p, ISP or Bcs1p BN ⁄ PAGE analysis of a yeast mutant strain in which the gene encoding the Qcr9p...
- 15
- 639
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the opistoporins ... parabutoporin, this could explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity ... Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria...
- 12
- 598
- 0
AN ACCOUNT OF TIMBUCTOO AND HOUSA, TERRITORIES IN THE INTERIOR OF Africa docx
... the city of Terodant and the port of Santa Cruz There is an emigration of the Mograffra Arabs, who are in possession of the country between Terodant and the port of Messa The encampments of an ... Country.-Dar El Beida, Fedalla, and Rabat described. Mausoleum of the Sultan Muhamed ben Abd Allah at Rabat. Of Sheila, a Roman Town. Of the Tower of Hassan. Road of Rabat. Productive Country about Rabat. ... Tildie.-Arab Repast there. Natural Strength of Santa Cruz, of the Town of Agurem, and the Portuguese Spring and Tank there. Attempt of the Danes to land and build a Fort.-Eligibility of the Situation...
- 387
- 381
- 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... shown) The structures of the other Hep3-glycoforms were obtained in an analogous manner (data not shown) and for all glycoforms the hexoses were found to be members of a linear chain attached ... methylated alditol acetates obtained in sugar- and methylation analyses correspond to the detector response of the GLC-MS Permethylation of dephosphorylated OS was performed in the same way as in the ... monosaccharide sequence and branching pattern Characterization of the Kdo-lipid A- OH region ESI-MS data (Table 1), fatty acid compositional analysis (yielding 3-hydroxytetradecanoic acid) and NMR experiments...
- 13
- 433
- 0
Considering the Creation of a Domestic Intelligence Agency in the United States pot
... Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ... in other Western democracies such as France, Britain, Germany, Italy, and Canada, ASIO derives much of this information from human sources A certain amount of data emanates from well-placed informants ... least because it was instrumental in creating an independent Catholic state out of the world’s largest Islamic polity; and the post-9/11 war against al Qaeda.3 At the same time, globalization and...
- 218
- 375
- 0
An Analysis of Business Administration Students Interest in the area of production and Operations pot
... courses, their interest in a career in this area, the importance of this area to their education and their mastery of managerial skills related to the area? In order to set an academic demarcation of ... Lima, Dorelland P and Andrade, Raphael J C.: An Analysis os Business Administration Students Interest in the Area of Production and Operations 100 Journal of Operations and Supply Chain Management ... Francisco J., Lima, Dorelland P and Andrade, Raphael J C.: An Analysis os Business Administration Students Interest in the Area of Production and Operations Journal of Operations and Supply Chain...
- 13
- 469
- 0
Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf
... translation (see below), amyH was amplified using chromosomal DNA of H hispanica as template, and primers AmyH-T 7a (atatcatATGAATCGACCCCGAATTACC GGCAG) and AmyH-T7b (atataagcttGTCTCCGTGGCG TGCCAGCTTACTG), ... plus NADH as indicated Lane contains the translation reaction of preAmyH, reactions in lanes 2–4 were performed using preAmyH dialysed against a buffer containing 2.5 M KCl, and reactions in lanes ... Quickchange mutagenesis were AmyKKfor (CCGGCAGTAAGCAGGCGTCTaagaaaACC GTTCTGAAAGGAATCG) and AmyKKrev (GGCCGTC ATTCGTCCGCAGAttctttTGGCAAGACTTTCCTTAGC) (bold letters indicate the nucleotides encoding the...
- 9
- 414
- 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... item and subscale correlations and internal reliability No missing values were found in any of the 44 items in the Brazilian sample The analysis of the pooled international data indicated the ... Items in bold were retained in the international final version the International dataset too Out of these, only item 18 remained in the final international AAQ version The Multi-trait Analysis ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection;...
- 10
- 871
- 0
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx
... item and subscale correlations and internal reliability No missing values were found in any of the 44 items in the Brazilian sample The analysis of the pooled international data indicated the ... Items in bold were retained in the international final version the International dataset too Out of these, only item 18 remained in the final international AAQ version The Multi-trait Analysis ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection;...
- 10
- 737
- 0
Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx
... domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality in the spaces of generalized ... Hyers-Ulam stability of the functional equations that have the quadratic property,” Journal of Mathematical Analysis and Applications, vol 222, no 1, pp 126–137, 1998 17 L Hormander, The Analysis of ... 2 Journal of Inequalities and Applications in the spaces of generalized functions Also, we obtain the general solution and prove the Hyers-Ulam stability of 1.1 in the spaces of generalized functions...
- 12
- 311
- 0
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps
... parenting courses in managing the child’s behaviour and psychoeducational materials are made available When pharmacological therapy is recommended, the various types of medication available and ... 10 years, had a long history of poor concentration, and defiant and challenging behaviour She was born following a normal pregnancy and delivery, and had a history of delay in all areas of her ... (MPH) and dexamfetamine, and the non-stimulant, atomoxetine, are licensed in the UK for the management of ADHD in school-age children and young people, and are effective in controlling ADHD symptoms...
- 24
- 597
- 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx
... c19orf10 staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... to the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant phenotypic changes ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining layer completely devoid of...
- 9
- 489
- 0
báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt
... demonstrated a thinly encapsulated neoplasm The diagnosis of a paraganglioma was confirmed by histologic and immunohistologic examinations Because vascular invasion and focal infiltration of the ... supervised the writing of the manuscript URL and HFH performed the operation HFH, URL and TL supervised the general management and follow-up of the patient All authors have read and approved the final ... Beasley A: Pre-operative embolisation of metastatic paraganglioma of the thoracic spine J Clin Neurosci 2010, 17:394-396 Page of 17 Falkmer S, Hansson G: Phaeochromocytomas and paragangliomas In...
- 6
- 323
- 0
Báo cáo y học: "The Colombian conflict: a description of a mental health program in the Department of Tolima" pdf
... rural population about the symptoms and consequences of traumatic events, to offer tips and advice on coping mechanisms, and an explanation of the mechanisms of psychotherapy At the end of the ... the MSFF program in Colombia Authorization for analyzing and publishing the data was sought from the Secretar a de Salud Departamental de Tolima Competing interests The authors declare that they ... psychological care and treatment in Ibague, the capital of the department of Tolima, and in various rural villages Three mental health teams provided services: two were mobile within the rural areas and...
- 6
- 317
- 0
Báo cáo y học: " Implementation of a delirium assessment tool in the ICU can influence haloperidol use" doc
... convinced that the intensive feedback and support of the project leader and the medical and nursing staff played an important role in achieving a high compliance Haloperidol treatment and patients ... MvdB carried out the study, gathered all data, performed the statistical analysis, and drafted the manuscript PP and LS supervised the conduct of the study and writing of the paper HvdH and TvA corrected ... thank J Schoemaker and J van der Velde for their excellent work of integrating the CAM-ICU in our patient data management system, and all the 'delirium key-nurses' for their work and assistance...
- 7
- 291
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25