0

an example of a computerized electronic nursing record system for inpatient care

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
báo cáo khoa học:

báo cáo khoa học: " Analysis of a post-translational steroid induction system for GIGANTEA in Arabidopsis" pdf

Báo cáo khoa học

... 5'-GAATTAGGGAACAGCCACGA-3' for CO, 5'-CTGGAACAACCTTTGGCA AT-3' and 5'-TACACTGTTTGCCTGCCAAG-3' for FT, 5'-CGAAAGCTTCCTCCTGGTTA-3' and 5'-GAGTTTTGCCCCTCACCATA-3' for SOC1, 5'-GATTCCACGAGTTTGGGAGA-3' ... Figure of conditions transcript application Analysis after DEX abundance of the TOC1 circadian clock gene in transgenic (TG) and control Arabidopsis plants in long day Analysis of transcript abundance ... 5'-GATTCCACGAGTTTGGGAGA-3' and 5'-CCTTAGCCATTGGGAGATCA-3' for TOC1, 5'-GCGTTGCCTCCTAATGGTAA-3' and 5'ACCCTCCAACTCCCTGTACC-3' for HAP 3A, 5'TGCTTTTTCATCGACACTGC-3' and 5'-CCATATGTGTCCGCAAAATG-3' for At2g32170,...
  • 13
  • 245
  • 0
Báo cáo y học:

Báo cáo y học: " Design, assembly, and validation of a nose-only inhalation exposure system for studies of aerosolized viable influenza H5N1 virus in ferrets" ppt

Báo cáo khoa học

... tracts that share many anatomic features with those of humans, and have metabolic and physiologic similarities with humans They are an appropriate animal model [34] for study of the pathogenicity ... the calculated V m for animals by a factor of about 2.9× with a high estimate of 0.345 L/min for V m , and a factor of 5× with a value of 0.2 L/min The same values apply to air changes; at 0.345 ... regulatory affairs and system validations, and to Dr Barry Astroff (MRI) for assistance in establishing a dedicated aerosol facility for inhalation exposure studies Drs Chad Roy (Tulane Univ., LA)...
  • 12
  • 369
  • 0
báo cáo khoa học:

báo cáo khoa học: "Multi-level analysis of electronic health record adoption by health care professionals: A study protocol" potx

Báo cáo khoa học

... 25:147-173 51 Damanpour F: Organizational innovation: A meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34:555-590 52 Kimberly JR, Evanisko MJ: Organizational innovation: ... J, Amara N, Landry R: Research-based-decision-making in Canadian health organizations: a behavioural approach J Med Syst 2007, 31:185-196 86 Landry R, Amara N, Lamari M: Utilization of Social ... influence of individual, organizational, and contextual factors on hospital adoption of technological and administrative innovations Acad Manage J 1981, 24:689-713 53 Lansisalmi H, Kivimaki M, Aalto...
  • 10
  • 250
  • 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Báo cáo khoa học

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...
  • 8
  • 341
  • 0
báo cáo khoa học:

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

Báo cáo khoa học

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...
  • 8
  • 315
  • 0
Báo cáo y học:

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Báo cáo khoa học

... basic research appeared to conclude what was already intuitively thought about low back pain and increased weight Body mass index Before an in-depth discussion of low back pain and obesity can ... The relation of spinal x-ray to low back pain and physical activity among 60 year old men and women Spine 1985, 10:445-451 Lean ME, Han TS, Seidell JC: Impairment of health and quality of life ... degeneration in an urban population Ann Rheum Dis 1958, 17:388-397 Magora A, Schwartz A: Relation between the low back pain syndrome and x-ray findings I: Degenerative osteoarthritis Scand J Rehabil...
  • 6
  • 402
  • 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

Sư phạm

... 4, Al-Issa, A (2006b) Language problems facing Omani learners of English ORTESOL, 24, pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing ... scientifically and objectively than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire ... has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The vocal characteristics of rate, volume, clarity, etc All...
  • 50
  • 454
  • 2
 Báo cáo y học:

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Y học thưởng thức

... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... the data, performed the statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript ... Foundation for Acute Medicine and a research fellowship from the Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak,...
  • 6
  • 611
  • 0
An example of table content

An example of table content

Tư liệu khác

... 6 Reference…………………………………………… Appendix: Questionnaire………………………… ...
  • 2
  • 347
  • 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

Hóa học - Dầu khí

... analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, first beam results, and ... development at CEA/Saclay Rev Sci Instrum 75(5): 1414–1416 http://laacg1.lanl.gov Poisson code, Reference manual, LA-UR-87-126, LANL 1987 Jain S K, Jain A, Sharma D, Hannurkar P R 2006 Acquisition and analysis ... Poisson software for (a) mirror magnetic field, and (b) flat magnetic field are shown in figure The calculation was also performed analytically (Montgomery 1966) using standard relations for calculating...
  • 8
  • 650
  • 0
Tài liệu An Example of Using the Get* Methods phần 1 pdf

Tài liệu An Example of Using the Get* Methods phần 1 pdf

Kỹ thuật lập trình

... type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID ... Console.WriteLine("ProductName database type = " + productsSqlDataReader.GetDataTypeName(productNameColPos)); Console.WriteLine("UnitPrice database type = " + productsSqlDataReader.GetDataTypeName(unitPriceColPos)); ... Console.WriteLine("ProductID database type = " + productsSqlDataReader.GetDataTypeName(productIDColPos)); This example displays: ProductID database type = int As you can see, the ProductID column is of the SQL...
  • 6
  • 594
  • 0
Tài liệu An Example of Using the Get* Methods phần 2 docx

Tài liệu An Example of Using the Get* Methods phần 2 docx

Kỹ thuật lập trình

... to use some of the methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... SqlDataReader productsSqlDataReader = mySqlCommand.ExecuteReader(); int productIDColPos = productsSqlDataReader.GetOrdinal("ProductID"); int productNameColPos = productsSqlDataReader.GetOrdinal("ProductName"); ... that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table The following while loop uses the GetSql* methods and returned...
  • 6
  • 471
  • 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Điện - Điện tử

... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...
  • 8
  • 492
  • 0
Tài liệu An Example of Communal Currency pdf

Tài liệu An Example of Communal Currency pdf

Quản trị kinh doanh

... out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case the amount ... remain out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case ... Josias le Marchant, James Carey and Jean le Marchant were still uneasy, and on 10th April, 1829, complained direct to Whitehall that "the States had exceeded their annual revenues for works of...
  • 37
  • 485
  • 0
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx

Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx

Báo cáo khoa học

... et al ˛ A B Fig MS spectra and results of HPLC analysis of (A) [FK]BiSFTI-1 (8) and (B) a mixture of b-trypsin and [FK]BiSFTI-1: peak 2, analogue without tripeptide Abu-Thr-Lys; peak 3, analogue ... chymotrypsin with a stoichiometry of : (analogues of and 7), whereas the two remaining analogues would inhibit both trypsin and chymotrypsin simultaneously and independently Jaulent and Leatherbarrow [11] ... 2762.4797 revealed the appearance of a : complex of trypsin with monocyclic SFTI-1 (Fig 3B) Essentially, an identical peak pattern was seen with an increasing incubation time of up to 20 h (data not...
  • 9
  • 307
  • 0
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt

Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt

Tổ chức sự kiện

... 2004) and changes in land-sea mask consistent with the latter, and an increase of psu to account for the ∼120 m sea-level lowering Vegetation and other land-surface characteristics as well as river-runoff ... regime, NADW formation takes place south of the Greenland-Scotland ridge At α = αc ≡ 1.7 a threshold associated with a drastic AMOC increase of more than 10 Sv and a northward shift of deep water formation ... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean...
  • 10
  • 566
  • 0
báo cáo hóa học:

báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx

Hóa học - Dầu khí

... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... increase Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection;...
  • 10
  • 871
  • 0
báo cáo hóa học:

báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx

Hóa học - Dầu khí

... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... increase Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection;...
  • 10
  • 737
  • 0
báo cáo hóa học:

báo cáo hóa học:" Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30" pdf

Hóa học - Dầu khí

... and Health Care Administration, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan, 3School of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan, 4Assessment Research Center, ... of measurement data for appropriate inferences: Important advances in reliability and validity theory In The Sage handbook of quantitative methodology for the social sciences Edited by: Kaplan ... module for data simulation For our approach to succeed, an Excel-VBA(visual basic for application) module according to the formulas of Cronbach's α (see Formula 1) and skewness (see Formula 2) was...
  • 8
  • 318
  • 0

Xem thêm