an equation with the kernel k t t 1 q t on the semiaxis

$báo cáo hóa học:" L^{infty} estimates of solutions for the quasilinear parabolic equation with nonlinear gradient term and L^1 data" ppt$

báo cáo hóa học:" L^{infty} estimates of solutions for the quasilinear parabolic equation with nonlinear gradient term and L^1 data" ppt

Ngày tải lên : 21/06/2014, 20:20

... Ak ≤ C1 q 2C k C1 q k Then it follows from (3 .15 ) that uqk /q q q + Ck γ ( u k k (3 .16 ) + 1) with γ = q θ 1 = q λ0 / (1 − µλ0 ) Then, (3 .14 ) becomes d u k dt k k + k 1 m+2 k+ 2 m+2 k+ m u m+2 ... µ (1 p /q) µ Ω u1+β /q p q 1+ β /q q u q ≤ C1 ≤ C1 u u 1 (1 p /q) τ 1 (1 p /q) τ u1+β /q ≤ C1 µ2 (1 p /q) q u1+β /q q u µ3 q (5.8) with µ2 = q, 1 = µ − q, µ3 = 1 (1 − p /q) and τ = N (µ − q) (q + β) (q + ... (1 1/ θ )(m+kn ) u (t) kn + C1 C0 θn kn u (t) kn 1 n u (t) kn dt 1+ σ ≤ Ckn ( u (t) kn + 1) , < t ≤ T, kn (m+kn )/θn kn (3 .19 ) or d u (t) dt kn kn − m+2 −m θn kn + C1 C0 u (t) m−βn kn 1 u (t) kn +βn kn 1+ σ...

19
291
0

Báo cáo y học: "Olanzapine-associated neuroleptic malignant syndrome: Is there an overlap with the serotonin syndrome" ppt

Ngày tải lên : 08/08/2014, 20:23

... reported in the international literature from January 19 96 to March 20 01 was conducted On the basis of the titles and information included in the abstracts, seventeen case reports were found [10 –26] ... symptoms, since the authors were mainly focusing on the description of NMS symptomatology http://www.general-hospital-psychiatry.com/content/2 /1/ 10 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 ... Reference MS 10 11 12 13 14 15 16 17 Johnson & Bruxner 10 Filice et al 11 Moltz & Coeytaux12 Henel et al13 Burkhard et al 14 Emborg15 Apple & Van Hauer16 Hickey et al17 Margolese & Chouinard18 Carcia...

3
556
0

Báo cáo y học: "Comprehensive evaluation of genetic variation in S100A7 suggests an association with the occurrence of allergic rhinitis" pptx

Ngày tải lên : 12/08/2014, 15:21

... candidate for further studies in relation to allergic inflammation Competing interests The author(s) declare that they have no competing interests Authors' contributions MB and CH coordinated the study ... group The analysis of this SNP was repeated using the Taqman platform Concordance was found in 99.6% of the comparisons with only two out of 550 comparisons being discordant between the Taqman and ... genotype in patients and SPT results The Kruskall-Wallis non-parametric test was used to test for effect of genotype on the level of allergy, as scored in skin prick test, among the patients All...

7
267
0

On the possibility of visual literacy and new intentions with digital images an engagement with the discrete image by bernard stiegler

Ngày tải lên : 16/10/2015, 11:57

... he states, is an “emanation of the referent 55” This means that it is constituted through the light that is reflected directly from the contours of the person in front of the lens In Barthes’ ... monism then is not only committed to the problematic conception that the entire mental sphere can be reduced to the brain and its activities but also an apparently unwarranted assumption that this ... for the importance of revenants- the returning past(s) at the heart of the present that cannot be banished In this sense the spectral logic is the logic of the trace or différance. 51 The specter...

138
522
0

control engineering an introduction with the use of matlab

Ngày tải lên : 09/03/2016, 10:19

... Equation A State Transformation State Representations of Transfer Functions State Transformations between Different Forms Evaluation of the State Transition Matrix 12 1 12 1 12 1 12 4 12 4 13 0 13 1 ... eBooks at bookboon.com Click on the ad to read more Control Engineering Contents 13 3 13 4 10 .7 Controllability and Observability 10 .8 Cascade Connection 11 11 .1 11. 2 11 .3 11 .4 11 .5 13 5 13 5 13 6 13 8 ... The Effect of Parameter Variations References 10 10 .1 10.2 10 .3 10 .4 10 .5 10 .6 92 92 93 96 10 1 10 3 10 4 10 5 10 5 10 5 10 7 10 9 11 0 11 4 12 0 State Space Methods Introduction Solution of the State Equation...

155
232
0

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Ngày tải lên : 07/03/2014, 16:20

... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 2 71) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively ... 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the ﬁrst PCR 5¢ primer and the second 3¢ ... conﬁrming the dissociation constant value for the couple SAg–TCR In addition, these experiments showed that the C26S mutation was nondisruptive for binding to Vb5.2 The superantigen activity of SSA and...

9
485
0

Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

Ngày tải lên : 24/03/2014, 04:21

... was constructed using the primers 5¢-GGAAGGATCCAATTCATTAAATGAAGA GTG-3¢ and 5¢-GGCTATAACGAATTCTGGGTACCC TGCAGCATG-3¢ This fragment was also cut with BamH1 and EcoR1 and ligated into pGEX-2TK The ... of these proteins compared to the total amount of SLP-76 in the CD3 treated lanes The 75-kDa protein comigrated exactly with SLP-76 These results indicate that both the SH2 domain and the PTBTyr ... some of these interactions are affected by a mutation in the SH2 domain of Shb, and consequently how the activation of JNK is affected To further study the effects of the mutation in the Shb...

10
408
0

plants and the k-t boundary

Ngày tải lên : 08/04/2014, 00:27

... Butte (2) (14 ) Pyramid Butte (1) Williston Basin, SW North Dakota Region, Appendix no., and Name 1 1 1 1 3 3 3 3 1 1 1 1 1 1 1 1 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 ... 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Snyder Site (28) Williston Basin, eastern Montana University of Mary Site 10 11 13 14 13 12 13 13 13 13 14 13 13 18 18 1 2 (27) Stumpf Site (26) ... Starkville North (48) Raton Basin, Colorado 1 1 1 1 1 1 1 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 14 1 15 8 13 15 16 16 20 10 1 1 1...

292
358
0

alligood k.t., yorke j.a, t.d.sauer. chaos.. an introduction to dynamical systems

Ngày tải lên : 24/04/2014, 17:08

... discovery that the motion of the planets and moons of the solar system resulted from a single fundamental source: the gravitational attraction of the bodies He demonstrated that the observed motion ... point of g(x) ϭ 2x (1 Ϫ x) Let x0 ϭ 0 .1 be the initial condition Then the ﬁrst iterate is x1 ϭ g(x0 ) ϭ 0 .18 Note that the point (x0 , x1 ) lies on the function graph, and (x1 , x1 ) lies on the ... diagonal line Connect these points with a horizontal dotted line to make a path Then ﬁnd x2 ϭ g(x1 ) ϭ 0.2952, and continue the path with a vertical dotted line to (x1 , x2 ) and with a horizontal...

612
566
0

Báo cáo sinh học: " Research Article On an Inverse Scattering Problem for a Discontinuous Sturm-Liouville Equation with a Spectral Parameter in the Boundary Condition'''' pptx

Ngày tải lên : 21/06/2014, 16:20

... problem 1. 1 – 1. 3 The fundamental equation is different from the classic equation of Marchenko and we call the equation the modified Marchenko equation The discontinuity of the function ρ x strongly ... problem 1. 1 – 1. 3 The fundamental equation is different from the classic equation of Marchenko and we call equation 3 .14 the modified Marchenko equation The discontinuity of the function ρ x strongly ... of 1. 1 It turns out that in this case the discontinuity of the function ρ x strongly influences the structure of representation of the Jost solution and the fundamental equation of the inverse...

17
289
0

Báo cáo sinh học: " Research Article On an Inverse Scattering Problem for a Discontinuous Sturm-Liouville Equation with a Spectral Parameter in the Boundary Condition" potx

Ngày tải lên : 21/06/2014, 16:20

... problem 1. 1 – 1. 3 The fundamental equation is different from the classic equation of Marchenko and we call the equation the modified Marchenko equation The discontinuity of the function ρ x strongly ... problem 1. 1 – 1. 3 The fundamental equation is different from the classic equation of Marchenko and we call equation 3 .14 the modified Marchenko equation The discontinuity of the function ρ x strongly ... of 1. 1 It turns out that in this case the discontinuity of the function ρ x strongly influences the structure of representation of the Jost solution and the fundamental equation of the inverse...

17
352
0

Easy PHP websites with the zend framework (w jason gilmore) (2011)(t)

Ngày tải lên : 23/06/2014, 13:03

... 12 0 12 1 12 1 12 3 12 5 12 6 12 9 13 0 13 0 13 0 13 1 13 2 13 2 13 4 13 7 13 9 14 1 14 4 14 7 14 7 15 2 15 2 Easy PHP Websites with the Zend Framework Testing the Login Process Ensuring an Authenticated ... Creating an Automated Password Recovery Feature Testing Your Work Making Sure the Login Form Exists v 10 5 10 6 10 6 10 7 10 8 10 8 10 9 10 9 11 0 11 2 11 3 11 4 11 5 11 6 11 7 11 8 12 0 ... Installing PHPUnit Configuring PHPUnit vi 15 3 15 4 15 4 15 5 15 6 15 7 15 8 16 5 16 7 16 7 16 8 16 9 17 3 17 5 17 5 17 6 17 9 18 0 18 1 18 1 18 2 18 2 18 3 18 4 18 5 18 6 18 8 18 9 19 3 19 3 19 9 200...

236
391
1

Báo cáo y học: " An association between the acute phase response and patterns of antigen induced T cell proliferation in juvenile idiopathic arthritis" ppt

Ngày tải lên : 09/08/2014, 01:23

... deviation of the mean value of proliferation to at least one antigen in the synovial fluid compartment did not overlap with the standard deviation of the mean value of proliferation to the same antigen ... 1/ 6 13 (9 14 ) 12 (1 60) 1/ 4 10 (5 14 ) 10 (4 12 9) ERA Polyarthritis RF– Polyarthritis RF+ 1/ 0 15 12 0 Other 0/2 11 (9 13 ) (3–3) 0 Total 39 17 /22 11 (2 17 ) 27 (1 17 5) 18 ANA, antinuclear antibody; ... where it can act as a chemoattractant for neutrophils, monocytes and lymphocytes, and it is possible that the accumulation of activated CD14+ monocytes may contribute to the different proliferative...

8
359
0

Báo cáo y học: "No evidence for an association between the -871 T/C promoter polymorphism in the B-cell-activating factor gene and primary Sjögren''''s syndrome" pptx

Ngày tải lên : 09/08/2014, 07:20

... fragment length polymorphism method in 16 2 unrelated French patients with pSS (11 0 patients with anti-SSA and/or anti-SSB autoantibodies and 52 patients without autoantibodies) Patients were defined ... in genetic predisposition to a specific pattern of autoantibody secretion either (T allele frequency in patients without autoantibody: 45%; in patients positive for anti-SSA autoantibody only: ... anti-SSB autoantibodies (n [%]) 52 (32) Anti-SSA autoantibody only (n [%]) 54 (33.4) Anti-SSA and anti-SSB autoantibodies (n [%]) BAFF; and 5'-GCTGTGCTACGTCGCCCT-3' and 5'-AAGGTAGTTTCGTGGATGCC-3'...

5
401
0

Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx

Ngày tải lên : 10/08/2014, 21:23

... chemotherapy Of these, 11 8 (88.7%) patients were treated with anthracycline-containing chemotherapy (e.g., CHOP or CHOPlike regimens) as first-line treatment and 15 (11 .3%) were treated without anthracycline-containing ... development and progression of cancers [26] There are some reports on the relationship between inflammation and cancer treatment outcomes via the transcription factors NF-B in PTCL [11 ,27] In our study, ... Korea Authors’ contributions YRK involved in conception, design, data interpretation, and manuscript writing JSK performed data interpretation and revising it critically for intellectual content...

9
312
0

Báo cáo y học: " Biliary peritonitis caused by a leaking T-tube fistula disconnected at the point of contact with the anterior abdominal wall: a case report" docx

Ngày tải lên : 11/08/2014, 21:22

... Figure Cannulation of T- tube fistula Cannulation of T- tube fistula Intraoperative laparoscopic photograph illustrating cannulation of T- tube fistula tract with 10 -Fr Latex drain lack of complete fibrous ... it provided an accurate diagnosis; second, it confirmed that the usual leak point (i.e the junction between fistula and CBD) was intact and did not therefore require a further Ttube placement, ... procedure The patient made an uneventful recovery postoperatively and was discharged with the T- tube spigotted and left in situ A T- tube cholangiogram weeks later excluded any bile duct obstruction...

4
439
0

Báo cáo y học: " Restriction by APOBEC3 proteins of endogenous retroviruses with an extracellular life cycle: ex vivo effects and in vivo "traces" on the murine IAPE and human HERV-K elements" pot

Ngày tải lên : 13/08/2014, 05:21

... ch 3 -10 29 K3 3 / ch10-0070 K1 8 / ch1 -15 90 K1 04 / ch5-0306 KCHR 21 / ch 21- 018 9 K3 7 / ch 11- 118 1 KI / ch3 -12 71 K4 1 / ch12-05 71 K1 02 / ch1 -15 39 K1 0 / ch5 -15 61 K1 15 / ch8-0074 K1 09 / ch6-0785 K5 0B / ... HERV -K 7350 7370 7390 7 410 7430 ACATGGTAAGCGGGATGTCACTCAGGCCACGGGTAAATTATTTACAAGACTTTTCTTATCAAAGATCATTAAAATTTAGACCTAAAGGGAAACCTTGCCC ch1 -15 39 ch1 -15 90 ch3 -10 29 ch3 -11 43 ch3 -12 71 ch3 -18 68 ch5-0306 ... copies These mutations are essentially G-to-A substitutions, with the effect being most probably "strandspecific", since the number of such mutations is almost twice that of the C-to -T substitutions...

11
277
0

Báo cáo y học: "Signatures of human regulatory T cells: an encounter with old friends and new" pdf

Ngày tải lên : 14/08/2014, 16:21

... 5'-CGA AGG GTC TCC GCG GGG TCA CAT-3' TNFRSF1B 5'-GTA GCC TTG CCC GGA TTC TGG-3' 5'-ACC CTG CCC CTG CTC TGC TA-3' TRAF1 5'-GGG GCA TAA ACT TTC CTC TTC C-3' 5'-TTT GGG GTT ATA CAT TGC TCA GTG-3' LGALS3 ... [34] Controversially, it has been reported that PTTG1 can activate TP53 and BAX to increase apoptotic function, but this seems to be rather an indirect effect of PTTG1 and is dependent on other ... (signal transducer and activator of transcription)4 or IL-4/STAT6 signaling pathways leading to a Th1/Th2 lineage specification that is further directed by the transcription factors T- bet and GATA3,...

18
389
0

an investigation of the polysemy of open close' in english and mở đóng in vietnamese (from the cognitive perspective) = nghiên cứu tính đa nghĩa của động từ mở đóng trong tiếng anh và tiếng việt t

Ngày tải lên : 02/03/2015, 14:30

... – Data Analysis– contains the core part of the study It presents, analyzes and synthesizes data collected This chapter applies the theoretical framework that is established in chapter into analyzing ... related theoretical foundation is done in the first chapter, serving as a background for the study to be carried out in the rest of the part Particularly, the first chapter displays my understanding ... OBJECTIVES OF THE STUDY RESEARCH QUESTIONS ORGANIZATION OF THE STUDY PART B: DEVELOPMENT CHAPTER I: LITERATURE REVIEW 1. 1 AN OVERVIEW ON CONTRASTIVE ANALYSIS...

7
483
2

An evaluation of the textbook English 11 taught at Phan Dinh Phung Secondary school in Hanoi. A case study = Đánh giá sách giáo khoa tiếng Anh 11 dạy ở trường T

Ngày tải lên : 28/03/2015, 08:49

... textbook and the curriculum, the fit between the textbook and the students, the fit between the textbook and the teachers, and overall evaluation of the fit of the book for the course in the program ... whether the language in the textbook was authentic and realistic The first question was raised to examine the extent to which the textbook encouraged the students to act out the meaningful conversations ... opinions and attitudes toward the textbook they are using The teachers and students were requested to complete the questionnaires relating to contents and methodology in the textbook The researcher...

65
2.9K
7