an array of characters is not a string

Tài liệu Báo cáo khoa học: Bacitracin is not a speciﬁc inhibitor of protein disulﬁde isomerase pptx

Ngày tải lên : 16/02/2014, 14:20

... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections caused ... thiol–disulﬁde exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding ... immobilized metal afﬁnity chromatography and anion exchange chromatography, as previously described for PDIs from Caenorhabditis elegans [40], except that for PDI a domain and DsbA, the anion exchange...

9
620
0

Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

Ngày tải lên : 22/03/2014, 20:20

... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the ﬁrst example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the ... (i.i.d.) Gaussian random variables with mean value and vari*This work was carried out, while the ﬁrst author was a member of the MaPhySto – Centre for Mathematical Physics and Stochastics, funded ... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in...

66
378
0

Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

Ngày tải lên : 09/08/2014, 09:20

... Japan Department of Radiation Oncology, Osaka University Graduate School of Medicine, Yamadaoka 2-2, Suita, 565-0871 Osaka, Japan 4Department of Maxillo-Facial Radiology, Osaka University Graduate ... Hyperfractionated or accelerated radiotherapy in head and neck cancer: a meta-analysis Lancet 2006, 368:843-54 11 Pignon JP, le Maître A, Maillard E, Bourhis J, MACH-NC Collaborative Group: Meta-analysis ... YY participated in the statistical analysis MK, SF, NK, KS and TN participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript...

7
367
0

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Ngày tải lên : 11/08/2014, 08:20

... Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... chosen that span introns of CD4 and CD8 genes in order to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed ... of GAPDH mRNA by QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according to the amount of GAPDH mRNA in the sample Authors' contributions Heather Jaspan conceived of the...

4
319
0

Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx

Ngày tải lên : 12/08/2014, 20:20

... group Author contributions TMV participated in the design of the study, data collection, data analysis and writing of the manuscript JHDV participated in data analysis and writing of the manuscript ... measurements were available than for others, and this may have influenced our results However, glucose measurements were taken randomly with each arterial blood gas analysis, and because mean ... undergoing transhiatal or transthoracic esophagectomy for cancer Ann Surg 2003, 237:35-43 Katz MH: Multivariable analysis: a primer for readers of medical research Ann Intern Med 2003, 138:644-650 Van...

6
368
0

Báo cáo y học: " Minimal acupuncture is not a valid placebo control in randomised controlled trials of acupuncture: a physiologist''''s perspective" pps

Ngày tải lên : 13/08/2014, 15:21

... analgesia: I: The scientific basis Anesth Analg 2008, 106:602-610 Okada K, Kawakita K: Analgesic Action of Acupuncture and Moxibustion: A Review of Unique Approaches in Japan Evid Based Complement Alternat ... acupuncture analgesia is probably associated with its counter-regulation of spinal glial activation, PTX-sensitive Gi/o protein-mediated and MAP kinase-mediated signal pathways, and downstream ... results may be obtained [25,26] It has been postulated that acupuncture analgesia, in the case of manual acupuncture, is manifested by the feeling of deqi During manual acupuncture, all types of afferent...

9
469
0

''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf

Ngày tải lên : 07/03/2014, 17:20

... disappointment at this announcement evaporated, however, when phone calls and instant messages from an anonymous source began claiming that the Majestic fire was arson and part of a larger and dangerous ... a "This is not a game" disclaimer [5] As you can imagine, an audience that is quite used to being told "This is not a game" does not back off easily, and they are currently still investigating ... have a symbolic diegetic meaning — for instance, a player manipulates an avatar through a flash environment to earn game world points that translate into game currency, or a player investigates...

10
583
0

Báo cáo Y học: Regulation of RAS in human platelets Evidence that activation of RAS is not sufﬁcient to lead to ERK1-2 phosphorylation pot

Ngày tải lên : 08/03/2014, 16:20

... translocation of RAS to the insoluble fraction and secondary responses, aggregation mediated by the integrin GPIIb-IIIa was inhibited by EGTA and the activation mediated by thromboxane A2 and ADP ... isoform ki- and N-RAS was not excluded [5] Activated RAS was detected with an anti-(pan RAS) Ig, which does not distinguish the various isoforms of RAS In Regulation of RAS in platelets (Eur J Biochem ... interaction between the links of the pathway For instance, MP1 can bind MEK and ERK1 supporting ERK1 activation [26], and kinase suppressor of RAS can bind RAF, MEK and ERK favouring activation of...

7
436
0

Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc

Ngày tải lên : 16/03/2014, 19:20

... F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C(ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ¯ A( a, a) D(ε, ε) E(¯ , a) a ¯ D(ε, ε) A (¯ , a) ... A, A , C, D, E, F}, Σ = {a, a, #}, and P consists of the following rules: S(x1 y1 , y2 x2 ) ← D(x1 , x2 ), C(y1 , y2 ) C(ε, #) ← S(aa¯ aa¯ , #¯ a aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a ... our proof is the notion of an n-decomposition of a string over {a, b, c}, which is similar to the notion of a derivation in head grammars, but independent of any particular grammar The parameter...

9
374
0

odysseus is not a hero

Ngày tải lên : 21/03/2014, 22:48

... members killed at Cyclops¹ because he was being greedy.III) Odysseus is cold-hearted A) He kills people without giving them a chance 1) Suitors 2) Disloyal maids B) He doesn¹t care about people ... this.Outline I) Introduction A) The average definition for a hero B) What Odysseus is like compared to the definition C) Odysseus isn¹t a hero II) Odysseus is self centered A) He doesn¹t take ... prevent deaths of crew membersIV) Odysseus is disloyal A) He had affairs with other women 1) Calypso 2) Circe B) Wife didn¹t betray him 1) with suitors 2) even though he was thought to be dead V)...

2
408
0

An Analysis of Power Consumption in a Smartphone doc

Ngày tải lên : 23/03/2014, 13:20

... on Performance Analysis of Systems and Software (San Jose, CA, USA, Apr 25–27 2007), IEEE Computer Society, pp 158–168 [3] B IRCHER , W L., AND J OHN , L K Analysis of dynamic power management ... NAND ﬂash and SD card, as well as the CPU and RAM, averaged over 10 iterations of each workload Table shows the corresponding data throughput, efﬁciency (including NAND/SD power and the CPU and ... the sense resistors were connected via twisted-pair wiring The key characteristics of this hardware are summarised in Table Characteristic Max sample rate Input ranges Resolution Accuracy Sensitivity...

14
719
0

Báo cáo toán học: "A hyponormal weighted shift whose spectrum is not a spectral set " doc

Ngày tải lên : 05/08/2014, 15:20

3
329
0

Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot

Ngày tải lên : 10/08/2014, 21:24

... forefoot pain Such patients can reach podiatrists through a number of referral routes with an initial diagnosis of mechanicallyrelated metatarsalgia The algorithm is easy to understand and apply and ... the management of rheumatoid arthritis [73] Arthritis and Musculoskeletal Alliance Standards of care for people with inflammatory arthritis [74] Podiatry Rheumatic Care Association Standards National ... prevalence of walking disability in an early arthritis cohort to be 57% [19] Case-series data reveal the early stages of irreversible foot-related walking disability and, by detailed gait analysis,...

10
383
0

Báo cáo y học: "Attitudes towards Chiropractic: An Analysis of Written Comments from a Survey of North American Orthopaedic Surgeons" potx

Ngày tải lên : 13/08/2014, 15:21

... achtopatientsafetyduringspinalmanipulation.aspx (Accessed on August 19, 2011) 18 Kopansky-Giles D, Papadopoulos C: Canadian chiropractic resources databank (CCRD): a profile of Canadian chiropractors J Can Chiropr Assoc ... Torrance david.torrance@gmail.com Abhaya V Kulkarni abhaya.kulkarni@sickkids.ca Brad Petrisor Petrisor@hhsc.ca Brian Drew drewb@hhsc.ca Mohit Bhandari bhandam@mcmaster.ca Correspondence to: Dr Jason ... Canadian Institutes of Health Research and Canadian Chiropractic Research Foundation Dr Bhandari is supported, in part, by a Canada Research Chair, McMaster University 20 REFERENCES Triano JJ, Goertz...

28
237
0

Báo cáo y học: " Off hour admission to an intensivist-led ICU is not associated with increased mortality" pps

Ngày tải lên : 13/08/2014, 16:21

... models Statistical analysis Data were collected prospectively in the ICU databases and analyzed with SPSS 16.0 (Chicago, IL, USA) Normally distributed data were reported as means ± standard deviation ... RDGG and the aggregate data, wrote the first version of the manuscript and together with PES and MvS-V supervised the preparation of the final manuscript JIvdS and RJB analyzed data of the OLVG and ... preparation of the final manuscript JHR and PES analyzed data of the GH and contributed in the preparation of the final manuscript References American College of Surgeons, Committee on trauma: Manual...

7
190
0

A Project is Not a Black Box docx

Ngày tải lên : 14/08/2014, 11:20

... variables change, and the changes are often interrelated Sensitivity analysis using scenarios can help in this regard Operating leverage = a % change in operating income % change in sales For a ... purchase the piston plane and demand is high, we should expand further at t = because this branch has the highest NPV Similarly, if we purchase the piston plane and demand is low:  The NPV of ... estimate is realized 93 a ‘Optimistic’ and ‘pessimistic’ rarely show the full probability distribution of outcomes b Sensitivity analysis changes variables one at a time, while in practice, all variables...

17
233
0

Báo cáo khoa học: Cyclosporin A-induced oxidative stress is not the consequence of an increase in mitochondrial membrane potential doc

Ngày tải lên : 30/03/2014, 08:20

... increases in cytosolic [Ca2+] in response to CsA and its analogs Both the intracellular Ca2+ chelator BAPTA and the extracellular Ca2+ chelator EGTA caused significant attenuation of the effects of ... was monitored with an excitation wavelength of 485 nm through a 530 nm bandpass filter in an FL500 fluorescent plate reader Statistical analysis Data were analyzed using prism for Windows (GraphPad ... derivative NIM811 Mol Pharmacol 62, 22–29 Diaz G, Diana A, Falchi AM, Gremo F, Pani A, Batetta B, Dessi S & Isola R (2001) Intra- and intercellular distribution of mitochondrial probes and changes...

10
455
0

Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Ngày tải lên : 25/10/2012, 11:40

... W&[31] 2000 China Asian Lee JM[22] 2000 China(Taiwan) Asian Casson AG[21] 2003 Canada Caucasian Roth MJ[32] 2004 China Asian Casson AG[20] 2006 Canada Caucasian Cai L[25] 2006 China Asian Murphy SJ[33] ... diagnosis of publication bias (Linear regression analysis, ref.[34] All analysis was done by using the Statistical Analysis System software (v.9.1.3, SAS Institute, Cary, NC) and Review Manage ... that there are main forms of esophageal cancer histologically, squamous cell carcinoma (SCC) and adenocarcinoma, and each has distinct etiologic and pathologic characteristics Squamous cell is...

9
615
0

Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx

Ngày tải lên : 20/12/2013, 23:15

... only a representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells...

8
416
0

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Ngày tải lên : 20/01/2014, 20:20

... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... response to your answers, you cannot skip and later return to any questions And, you cannot rethink and change your answer at a later time You cannot seek out and answer the easier question styles first ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...

696
1K
1