american national standards institute a highly in uential
Tài liệu Congressional Government A Study in American Politics pdf
Ngày tải lên :
21/02/2014, 08:20
... business, in order that they might have the advantage of administrative knowledge and training in advising legislation and drafting laws to be submitted to parliament This arrangement enlists the majority ... legislation, so in finance, we have many masters acting under a very dim and inoperative accountability Of course under such ministration our financial policy has always been unstable, and has often ... integral parts of the machinery of administration, Congress was extending its own sphere of activity, was getting into the habit of investigating and managing every thing The executive was losing and...
- 113
- 336
- 0
AMERICAN HERO-MYTHS. A STUDY IN THE NATIVE RELIGIONS OF THE WESTERN CONTINENT potx
Ngày tải lên :
22/03/2014, 22:20
... runaway slave to explain the cognomen It may also occur in the same language In an Algonkin dialect missi wabu means "the great light of the dawn;" and a common large rabbit was called missabo; ... way, and must always direct their course by the cardinal points The morning star, which at certain seasons heralds the dawn, was sacred to him, and its name in Ojibway is Wabanang, from Waban, ... each had in his own keeping As therefore a contest with ordinary weapons would have been vain and unavailing, they agreed to tell each other what to each was the fatal implement of war Ioskeha...
- 196
- 491
- 0
National Standards in K–12 Personal Finance Education ppt
Ngày tải lên :
29/03/2014, 18:20
... to: personal finance as a financially literate older • Find, evaluate, and apply financial information adult Financially literate high school graduates, • Set financial goals and plan to achieve ... to manage spending and achieve financial goals Develop a plan for Describe how to allocate a weekly allowance among the financial goals of spending, saving, and sharing Calculate the sales tax ... original design and layout of this booklet Introduction The National Standards in K–12 Personal Finance Financial literacy is not an absolute state; it is a Education, created and maintained...
- 52
- 224
- 0
scientific american - 2002 06 - spintronics - a new twist in computing
Ngày tải lên :
12/05/2014, 16:12
... Thailand are based on a combination of clades B and E, and in April the International AIDS Vaccine Initiative expanded tests of a clade A derived vaccine in Kenya, where clade A is found But in January, ... primates SOUTH CHINA SEA MALAYSIA BORNEO SUMATRA INDONESIA INDIAN OCEAN JAVA Present-Day Orangutan Range HUNDREDS OF THOUSANDS of orangutans roamed throughout Southeast Asia about 10,000 years ago, ... (20,000 in North America) Although several potential AIDS vaccines are in clinical tests, so far none has lived up to its early promise Time and again researchers have obtained tantalizing preliminary...
- 87
- 798
- 0
báo cáo sinh học:" Human resource management in the Georgian National Immunization Program: a baseline assessment" pot
Ngày tải lên :
18/06/2014, 17:20
... supervision in Georgia We thank and acknowledge the staff of Curatio International Foundation involved in acquisition of data: Natia Rukhadze, Natalia Zakareishvili, Tea Kutateladze References Buchan ... organizational issues as well as training programs at the local levels to enhance human resource management capacity Issues relating to financial constraints, infrastructure and poor working ... management format and mandate, resource constraints, and financial and professional motivation as barriers Managers did not seem to think that their own management capacity was an issue We analysed responses...
- 10
- 540
- 1
báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx
Ngày tải lên :
18/06/2014, 17:20
... Federal Medical Reserve Corps n /a n /a (0) Shadowing an active physician n /a n /a 10.6 (24) Had retraining before reentering medicine Yes Retraining experience Online continuing medical education ... contributions EAJ was principal investigator and acquired the funding EAJ and HRR designed the survey SEB and HRR acquired the data HRR analyzed the data and all three authors interpreted the data, wrote ... was supported by a grant from the American Medical Association Women Physicians Congress through the Joan F Giambalvo Memorial Scholarship, to aid in data acquisition, survey printing and mailing,...
- 10
- 552
- 0
báo cáo hóa học:" Immunological response to highly active antiretroviral therapy following treatment for prevention of mother to child transmission of HIV-1: a study in Côte d’Ivoire" pdf
Ngày tải lên :
20/06/2014, 08:20
... immunological and clinical data Other study variables measured at time of HAART initiation were included in the analysis: age, WHO clinical stage, body mass index, hemoglobinemia at HAART initiation, and ... Hôpital Necker Enfants Malades, Paris, France 5MTCT-Plus initiative, ACONDA, Abidjan, Côte d’Ivoire 6MTCT-Plus Initiative, International Center for AIDS Care and Treatment Programs, Mailman School ... few data are available on long-term follow up of ART treatment in low income-countries to make any comparison between studies In sub-Saharan Page of Africa, 38% of patients were lost to care and...
- 5
- 407
- 0
Thesis: Directness in conversations in american english and vietnamese A comparative study
Ngày tải lên :
04/07/2014, 06:12
... between American English and Vietnamese, particularly in conversations Certainly, these differences can cause certain cross-cultural problems for American and Vietnamese speakers Approaching cross-culture ... casual of conversations have an interactional function Casual conversations in parties can have the practical task of ascertaining whether the future social cohesion is possible or desirable and, ... or indirectness in their conversations are appropriate In all speech acts, they always maintain in Cooperative principle in three types, direct speech act, indirect speech act, and direct and indirect...
- 53
- 623
- 3
Báo cáo lâm nghiệp: "and nutrient cycling of a highly productive Corsican pine stand on former heathland in northern Belgium" docx
Ngày tải lên :
09/08/2014, 04:20
... model Na is assumed not to be influenced by exchange and Ca-, Mg- and K-bearing particles are assumed to have the same mass median diameter as Na- containing particles [9] The particle interception ... generation pine stands established on former heathlands and sand dunes The forest is located at the edge of the High Campine plateau and ranges in elevation from 50 to 58 m The Campine plateau ... deposition has perhaps been off- by a shift towards the woody parts or a gradual increase in foliar biomass Aber et al [1] suggested that in the initial stages of the development of nitrogen saturation,...
- 17
- 253
- 0
báo cáo khoa học: "Selection for abdominal bristle number in Drosophila subobscura, a highly polymorphic species" ppsx
Ngày tải lên :
09/08/2014, 22:22
... important are REVOSTI P (1967), while artificially selecting for an adaptative trait, wing length, in Drosophila subobscura, found a stronger response than that obtained in Drosophila melanogaster ... females of a wild population of D subobscura, from Ribarroja (Valencia, Spain), was used to start the population used in this experiment The population was maintained in the laboratory for months ... in a neutral trait For this reason, an artificial selection experiment for abdominal bristle number in D subobscura was initiated Abdominal bristle number is classically considered to be a neutral...
- 10
- 246
- 0
báo cáo khoa học: " A highly conserved NB-LRR encoding gene cluster effective against Setosphaeria turcica in sorghum" potx
Ngày tải lên :
11/08/2014, 11:21
... fungal DNA was extracted using a modified CTAB method [42] DNA was analyzed by using S turcica specific ITS1 and ITS2 primers (F – GCAACAGTGCTCTGCTGAAA and R-ATAAGACGGCCAACACCAAG) PCR was carried ... cDNA-AFLP analysis Water treated control samples were harvested at the same time-points 14 RNA extraction and cDNA-AFLP analysis Total RNA was isolated from the leaf samples using the BioRad RNA ... modified via various genic and intergenic processes enabling rapid evolution and adaptation to changes in a pathogen genome [10] R-genes can also act in pairs [11,12] The R-gene pairs can differ in genomic...
- 35
- 189
- 0
báo cáo khoa học: " Does harm reduction programming make a difference in the lives of highly marginalized, at-risk drug users?" pot
Ngày tải lên :
11/08/2014, 20:20
... conducting HIV primary care, HIV testing, STD screening, ob-gyn examinations, minor surgery, health screenings, and influenza vaccines; • Health education, including safer injection education and ... 348(9003):987-891 Hagan H, Des Jarlais DC, Friedman SR, Purchase D, Alter MJ: Reduced risk of hepatitis B and hepatitis C among injecting drug users participating in the Tacoma syringe exchange program Am J ... counseling and testing, primary care, intensive case management, drug treatment, housing, and mental health and nutritional services; • Access to early intervention to locate, identify, engage, and...
- 7
- 263
- 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
Ngày tải lên :
12/08/2014, 01:22
... vitro standard external positive sense TCCAGCAAATACACCATCCA In vitro standard external negative sense CTGCTTCACCACCCAATTTT In vitro standard nested positive sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 ... ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA ... synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive sense-specific QPCR primer CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific...
- 11
- 348
- 0
Báo cáo y học: " A highly attenuated recombinant human respiratory syncytial virus lacking the G protein induces long-lasting protection in cotton rats" pot
Ngày tải lên :
12/08/2014, 04:20
... inoculation with live attenuated vaccine candidates [7] These are important facts in favor of a live attenuated RSV vaccine administered intranasally The most challenging aspect of developing a live ... response in human volunteers after intranasal administration, and was considered to be over-attenuated as a vaccine candidate In the bovine model, however, a recombinant bovine RSV deletion mutant ... [21,22] A recombinant bRSV lacking the G gene induced bRSV neutralizing antibodies after intranasal immunization of calves Although it was not clear whether this mutant was able to replicate in the...
- 10
- 242
- 0
Báo cáo y học: "Expression Section in the HIV Drug Resistance Program at the National Cancer Institute-Frederick" pdf
Ngày tải lên :
12/08/2014, 23:22
... themselves as artists, it's apparent that they are Dave was an artist and actually received some artistic training early in his life A giveaway was Dave's method when drawing figures during lectures ... them in the broader context of earlier and present works in the field As a colleague, David was always generous in providing help and in sharing ideas and reagents He was a senior statesman in ... original sense, he was a good man Kuan-Teh Jeang, Senior Investigator and Chief, Molecular Virology Section, National Institute of Allergy and Infectious Diseases/NIH When I heard about David's...
- 5
- 224
- 0
towards sustainability of land use in a highly vulnerable and degraded
Ngày tải lên :
11/09/2015, 15:45
... clay shale, marl Bearing Eumorphotis reticulata, E inaequicostata, Claraia aurita, C stachei Thickness 310m 12 T1 Viên Nam Formation: aphyric basalt, magnesium-high basalt, andesitobasalt, andesitodacite, ... which allows representing, manipulating, storing, and analyzing features on the Earth’s surface, that are geographically and spatially referenced Since originated, it has been defined in many different ... spatially distributed features, activities, or events, which are definable in space as points, lines, or areas A GIS manipulates data about these points, lines, and areas to retrieve data for ad...
- 230
- 583
- 0
A cross national study of senior volunteerism in two non government organizations in singapore and p r china
Ngày tải lên :
16/09/2015, 12:34
... by applying familiar knowledge, skills and strategies Applied to activities, continuity theory maintains that adults gradually develop stable patterns of activity and that, in adapting to ageing, ... undergraduates in the mainland China (Du and Guo, 2000) Thus it is urgent for the mainland China to make more efforts to prepare for an ageing society Why Compare Singapore and China? As we can see ... 200 1a, 2001b, and 2000; Black and Kovacs, 1999; Young and Glasgow, 1998; Wasserbaurer, Arrington, and Abraham, 1997; Caro and Bass, 1997; Herzog and Morgan, 1993) and Australia (Warburtor, et al.,...
- 184
- 471
- 0
Jewish Involvement in Shaping American Immigration Policy, 18811965: A Historical Review
Ngày tải lên :
14/04/2016, 18:02
... aversion among Americans In advancing this proposal for 'new guidelines and standards' in determining admissions, President Eisenhower has courageously taken a stand in advance of even many advocates ... 106) pointedly noted that the 1924 legislation had succeeded in maintaining the racial status quo and that the main barrier to changing the racial status quo was not the national origins system ... constituted less than 12% of the population) As an example illustrating the fundamental argument asserting a legitimate ethnic interest in maintaining an ethnic status quo without claiming racial superiority,...
- 62
- 218
- 0
Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam
Ngày tải lên :
20/06/2016, 23:20
... (ROS) in apoptosis induction Apoptosis 5(5):415-418 Anonymous (Metastatic Cancer (National Cancer Institute) Anonymous (2006) What you need to know about cancer (National Institutes of Health), (Institute ... gene leads to an activated BRAF protein that enhances melanoma growth and metastasis Targeting specifically the mutant BRAF protein and not the wild type BRAF protein in normal cells with small ... Therapies (National Cancer Institute) 13 Anonymous (2012) Cancer Surveillance Programs in the United States (American Cancer Society) 14 Siegel R, Naishadham D, & Jemal A (2013) Cancer statistics,...
- 7
- 461
- 0
Cambridge.University.Press.War.Land.on.the.Eastern.Front.Culture.National.Identity.and.German.Occupation.in.World.War.I.May.2000.pdf
Ngày tải lên :
21/09/2012, 11:02
... Russia Fears grew of Russian surprise attack and nightmares of the Slavic advance of peasant giants gained currency in the popular imagination Increasingly isolated by its diplomatic blunderings, ... for the imagination, but seemed a tabula rasa, where man was still young, a noble savage for all that he was in chains Generally, the picture of Russia in the public imagination of the early twenti- ... were again lost to the Russians in their late fall campaign To the south, Austria’s attack into Russian Poland met with disaster Austrian armies were turned back and pushed almost to Cracow by...
- 320
- 957
- 3