alternative bids are frequently in response to a requirement specified in the bid documents sometimes bidders submit alternative bids voluntarily
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx
... [16] Using the guidance for ligand binding assays [12] as a foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell ... dosed) individuals where assessed using the internalization assay The assay variability in the placebo data is 15.5% over the 113 days of sampling (day-3 time point included for a total of 528 samples) ... end, a whole blood alexa-488 labeled MCP-1 internalization assay was validated here for use in clinical trials investigating a CCR2 antagonist by examining a standard reagent concentration to use,...
- 12
- 829
- 0
Báo cáo khoa học: "Osmotic adjustment in Pinus pinaster cuttings in response to a soil drying cycle" pptx
... ΨΠ, and the ΨΠ value varie with both investigator and species, summarize the effects of the variations in the ln RWC/(–ln (–ΨΠ)) relationship, and are calculated by many authors as an indicator ... whole plant leaf area was not estimated, it can be suggested that taller cuttings likely had larger transpiring leaf area and so consumed more water When subjected to water limitation in a restricted ... and A = [21] When the increase in solute concentration was more than that resulting from a decrease in water content (the passive component), then osmoregulation was active and A was less than...
- 5
- 291
- 0
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... performances of all the ,i d Y of a animals is where us and vs are parts of equation (42), and Cs are submatrices of equation (44) Note that all the individuals in the analysis are involved in these ... (23) and analogous for the sire model, hold for weak selection, and their expressions as ratios of a covariance to a variance indicate that they can also be obtained from a linear approximation ... just equal to half the latter Breeding animals are ranked according to their estimated genetic value In the present context, due to the non-linearity of the model, we define, for a candidate to selection...
- 29
- 347
- 0
Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx
... response in the asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain in the asthmatic airway during a DI is taken up by increased ... dilate their airway in response to a DI or, more often, exhibit further bronchoconstriction [16,19] These new data imply, however, that peak mechanical strains in the airway wall during the DI are ... endogenous dilating substance such as nitric oxide [11] Taken together, the weight of available evidence seems to support the idea that loss of the dilating response to a DI may indeed play a central role...
- 3
- 252
- 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt
... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview ... before in other Sub-Saharan African settings The translators were extensively trained and the translation was discussed in detail Nevertheless, cultural bias might have influenced the findings, as ... practicing in joint interviews to achieve a high interrater reliability All instruments were translated wordby-word into Kiswahili and the translation was intensely discussed to guarantee a precise...
- 9
- 405
- 0
Tài liệu Preparedness and Response to a Mass Casualty Event Resulting from Terrorist Use of Explosives pdf
... organizational response, standards of care, and surge capacity Meta-leaders build and maintain relationships and establish clear channels of communication Meta-leaders build and maintain relationships ... direct hazard impact areas and stage them into the EMS system for triage and distribution to definitive care • Establish patient holding areas to prepare for formal triage and treatment protocols ... Delayed Notification and Activation: Delays in delivering lifesaving interventions and definitive care are caused by taking a reactive approach (partial, gradual, and linear activation of emergency...
- 36
- 478
- 0
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc
... construction of the domains A0 and B0 that at the point r the boundaries of Ax0 and B x0 are tangent to each other and that this tangency is quadratic We will look for the map h0 near the point r in the ... way onto the domain A (so that there is a critical point of g in the central domain), • All other components of B are mapped univalently onto A by the map g, • The iterates of the critical point ... f0 and fλ are combinatorially equivalent, then the maps F0 and Fλ are combinatorially equivalent as well Due to the rigidity theorem and straighten˜ ing Theorem 5.7 we know that there is a q.c...
- 44
- 412
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, distinguished by different migration in a 1% agarose gel The ... approximately 47 kDa are also recognized Apparent molecular masses are indicated by arrows The cell extracts were monitored for PKA-specific kinase activity against kemptide using c-[32P]ATP and...
- 13
- 344
- 0
Báo cáo y học: "Schizophrenia pathophysiology: are we any closer to a complete model" pps
... pregnancy, creating histopathological damage to specific areas of the brain Additionally, exposure to significant environmental factors has been shown to lead to the development of schizophrenia Apparent ... that are associated with alterations in gene expression in brain regions that appear to play a significant role in the pathophysiology of schizophrenia [36] Other studies indicated that dopamine ... schizophrenia Both expression and functional studies indicate that the gene product, D-amino acid oxidase activator, may have an important interaction with an amino oxidase to modulate its enzymatic activity...
- 8
- 392
- 0
Báo cáo y học: " Hemoglobin a and b are ubiquitous in the human lung, decline in idiopathic pulmonary fibrosis but not in COPD" potx
... conceived the study, and participated in its design and coordination and helped to draft the manuscript All authors have read and approved the final manuscript Acknowledgements The authors thank Tiina ... forms being localized mainly in the alveolar epithelium of COPD lungs A detailed MS-analysis indicated that a disturbance in the complex formation of Hba in the IPF lung was associated with the modification ... in the alveolar epithelium as well as in macrophages in the control and COPD lungs The alveolar epithelium (arrows) of patients with IPF displayed very weak staining in contrast to the situation...
- 13
- 349
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
... resuspended in 100 μl of assay buffer and analyzed by using a Luminex 100 machine (Luminex Corporation, Austin, TX, USA) The total assay time was hours The assay had a broad range (~100 pg/ml to 25 ... including mediating inflammatory responses and facilitating adaptive immunity [9-11] The binding of BLyS and APRIL to TACI, BCMA, and BAFF-R receptors also triggers the upregulation or downregulation ... used as a standard to develop a bead-based immunoassay by using antiAPRIL capture mAb and fluorescence-labeled anti-BLyS detection mAb to quantify native heterotrimers in human sera The bead-based...
- 14
- 460
- 0
Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx
... remunerations, to being classed as primary healthcare professionals in the USA and this may encourage chiropractors there to pursue a primary healthcare title This might explain the apparent difference in ... other healthcare professionals and promoting interdisciplinary care including becoming more involved with primary healthcare teams within the NHS List of abbreviations AAFP: The American Academy ... be easier for a chiropractor to claim a primary healthcare role in the UK than in the USA However due to the differences in the healthcare systems there are other benefits, such as remunerations,...
- 12
- 523
- 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx
... than expected,” they say Among the newcomers since the 1990s is Finland’s Nokia, which surfed in on the IT wave and has maintained its hold at the top Together with the Japanese giant Toyota, the ... situation that brought home to many the idea that climate change, whether natural or man-made, was a real threat to human existence The rain that swamped the northern half of Queensland at the ... bag -in- box packaging fi rst saw the light of day in the US in the mid-1950s Back then, it was a matter of fi nding a safe method for transporting used battery acid The big breakthrough in packaging...
- 36
- 485
- 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
... following primers: 2.1up, AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG ... Functional and structural characterization of the catalytic domain of the starch synthase III from Arabidopsis thaliana Proteins 70, 31–40 Senoura T, Asao A, Takashima Y, Isono N, Hamada S, Ito H ... tandem repeats (i.e C-terminal domains from Lactobacillus manihotivorans a- amylase); (v) CBM34, present in the N-terminal domains of neopullulanase, maltogenic amylase and cyclomaltodextrinase; (vi)...
- 13
- 457
- 0
d. to stay --> b 114. A artist went to a beautiful part of the country for a holiday, and stayed pdf
... weather was fine a often b together c when d was > a 139 In England nobody under the age of eighteen are allowed to drink in a public bar a In b nobody c are d to drink > c 140 There is a prison ... wintering c of d like > a 236 It is certainly true that the average woman has weaker muscles that the average man a certainly b average c has d that > d 237 When men lived in caves and hunt animals ... did the other person say d what was the other person saying > b The salary of a bus driver is much higher a in comparison with the salary of a teacher b than a teacher c than that of a teacher...
- 28
- 2,221
- 1
Báo cáo toán học: "Dissimilarity vectors of trees are contained in the tropical Grassmannian" potx
... n leaves gives a point in the tropical Grassmannian Gm,n , and therefore gives rise to a tropical linear space The combinatorial structure of those tropical linear spaces is the subject of an ... of size m and dσ is the total weight of the smallest subtree of T which contains the leaves in σ By the total weight of a tree, we mean the sum of the weights of all the edges in that tree Definition ... Grassmannian the electronic journal of combinatorics 17 (2010), #N6 We have the following fundamental characterization of Gm,n which is a direct application of [9, Theorem 2.1] a Theorem 2.3 The...
- 7
- 330
- 0
Báo cáo toán học: "Zeros of the Jones polynomial are dense in the complex plane" pdf
... ±tk/2 Then by applying Beraha-KahaneWeiss’s Theorem, we obtain the lemma The following Sokal’s lemma [10] will play an important role in proving our main result Lemma 3.3 Let F1 , F2 , G be analytic ... Let Ha be the graph obtained from Ha by identifying u and w, the two attached vertices of Ha Let ′ (dQ[Ha ] − Q[Ha ]), −1 ′ a = β[Ha ] = (dQ[Ha ] − Q[Ha ]), d −1 α[Ha ] a = γ[Ha ] = + d β[Ha ... in some regions, for example, a small circle region around z = and a large area in the left half complex plane But in this paper by considering zeros of pretzel links we shall show that, on the...
- 10
- 302
- 0
Báo cáo y học: " MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppt
... bones and metacarpal bases to 5) and fingers (metacarpals proximal to bases, metacarpophalangeal (MCP) joints, proximal phalanges, proximal interphalangeal (PIP) joints, middle phalanges, distal interphalangeal ... recruitment and participated in data analysis QR was a reader for the X-rays and assisted in manuscript preparation ER provided statistical advice and assisted in data analysis and manuscript preparation ... sequence was obtained after intravenous administration of the contrast agent, gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA) Scans were scored separately by two trained readers (MØ and AD)...
- 9
- 521
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25