0

aliskiren hydrochlorothiazide combination for the treatment of hypertension a meta analytical revision

Báo cáo y học:

Báo cáo y học: "Barbiturates for the treatment of intracranial hypertension after traumatic brain injury" ppsx

Báo cáo khoa học

... proven that EBS is a requirement for these neurochemical changes [6,7] These data cast doubt on the argument that patients benefit maximally from barbiturate protocols that include EBS as a therapeutic ... JM, Raurich JM, Frontera G, Brell M, Ibanez J, Ibanez J: Pentobarbital versus thiopental in the treatment of refractory intracranial hypertension in patients with traumatic brain injury: a randomized ... been realized in clinical trials [10]? Perhaps by the time barbiturates are employed for refractory ICP - often several days after the trauma - the opportunity for the drugs to prevent secondary...
  • 2
  • 327
  • 0
Báo cáo y học:

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Y học thưởng thức

... de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and capsular tissue Limitations of the current study include a lack of comparison group and lack of blinding ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16 ... men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients...
  • 4
  • 599
  • 0
Báo cáo y học:

Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Y học thưởng thức

... Thoracic radiculopathy is rare, as evidenced by the paucity of literature regarding the appropriate management of these patients In our experience, patients with thoracic central and foraminal ... central or foraminal stenosis treated with endoscopic laminoforaminoplasty via a small incision, of less than one inch Materials and Methods Twelve patients were treated with endoscopic laminoforaminoplasty ... and carries significant risks The anterior approach requires a transthoracic approach with close proximity to the major abdominal and thoracic organs and neurovasculature [4], and posterior approaches...
  • 3
  • 506
  • 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Môi trường

... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the ... laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis ... the cause of partial nitriifcation, the authors operated a test plant using simulated coak-oven wastewater prepared with chemical reagents for a period of about one year The nitrifiers population...
  • 8
  • 572
  • 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Môi trường

... the increased HRT of the adsorption tank From an engineering application point of view, the appropriate operational parameters of the recycle ratio, HRT of the regeneration tank, HRT of the adsorption ... process had a great influence on the overall system performance Adsorptive capability of the sludge in CARS system The adsorptive rate and specific adsorptive capacity of the activated sludge are described ... concentration (mg/L); qm and b are constant characteristic of the system for the Langmuir model that can be considered as an indicator of adsorptive capacity and appetency, respectively; and KF and...
  • 8
  • 686
  • 0
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Sức khỏe giới tính

... within years of initial diagnosis) The 5-year survival rate for metastatic colorectal disease is 12% 2.4 The management of metastatic colorectal cancer is mainly palliative and involves a combination ... advanced or metastatic colorectal cancer Preliminary data have been presented The bevacizumab monotherapy arm was prematurely halted because of lack of efficacy • The first-line use of cetuximab ... of the patients in the cetuximab monotherapy arm of the RCT The data from the monotherapy arm NICE technology appraisal guidance 118 15 were adjusted to remove the impact of cetuximab using an...
  • 34
  • 853
  • 0
Hydroxyurea for the Treatment of Sickle Cell Disease docx

Hydroxyurea for the Treatment of Sickle Cell Disease docx

Sức khỏe trẻ em

... selected data elements against the original articles If there was a discrepancy between the data abstracted and the data appearing in the article, this discrepancy was brought to the attention of the ... hydroxyurea treatment? What are the barriers to the use of hydroxyurea treatment (and other therapies) for patients who have sickle cell disease and what are the potential solutions? What are the future ... investigator in charge of the specific data set, and the data were corrected in the final evidence tables We did not quantitatively pool the data for any of the outcomes because there was a paucity of...
  • 298
  • 1,113
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học

... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... compilation ª 2007 FEBS 3779 Modulation of metal availability for treating AD P J Crouch et al established, but the role for metal dyshomeostasis in all aspects is clear In the AD affected brain, metal...
  • 9
  • 634
  • 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt

Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt

Báo cáo khoa học

... PE38) has undergone several early-phase clinical trials for the treatment of B cell malignancies [35–37] These trials have validated the use of CD22 as a target and highlighted several potential ... of the majority of domain Ia (D1–250) and a portion of domain Ib (D365–380) from native PE Several RITs incorporating a 38 kDa fragment of PE are in preclinical evaluation or have already reached ... of PE and its intoxication pathway have fueled the translation of basic research into clinical therapies that have the opportunity to make a large positive impact on human health High expectations...
  • 18
  • 528
  • 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Sức khỏe phụ nữ

... with adjunctive therapy or the actual exercise dosage is the critical factor is unclear The optimal length of treatment and the number of treatment episodes could be useful information for the marketing ... quantity and quality of the educational information about the condition and PFM function The impact of these factors on the outcome of treatment has yet to be evaluated Furthermore, it has been ... Hay-Smith (2002) A A = available in English only as abstract; a = According to Australian National Health and Medical Research Council Hierarchy of Evidence (1998); b = Mean age (SD) unless otherwise...
  • 28
  • 738
  • 0
Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx

Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx

Sức khỏe giới tính

... Guideline for the Management of Clinically Localized Prostate Cancer: 2007 Update1, insufficient information was available to include cryosurgery in data meta- analyses As such, the AUA convened a Panel ... 2008 American Urological Association Education and Research, Inc.® Abbreviations and Acronyms ASTRO = American Society for Therapeutic Radiology and Oncology AUA = American Urological Association ... AT, VanBuskirk RG, Baust JG, Gage AA and Baust JM: Targeted induction of apoptosis via TRAIL and cryoablation: a novel strategy for the treatment of prostate cancer Prostate Cancer Prostatic...
  • 51
  • 417
  • 0
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE

SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE

Tiến sĩ

... three-way catalysts based on mixed metal oxides for the treatment of exhaust gases from internal combustion engine software package CasaXPS (Casa Software Ltd., UK) All spectra were calibrated for a ... to the combination of two oxides at favorable molar ratios Nguyen The Tien 48 Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment ... These maintain a rather strong synergistic effect between Mn and Ce species on the nanometer scale for the aged alumina-modified catalyst, and increase the amount of available active oxygen for...
  • 117
  • 376
  • 0
báo cáo hóa học:

báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf

Hóa học - Dầu khí

... preclinical data supporting the use of Alemtuzumab as a therapeutic agent for ovarian cancer patients Materials and methods Tissues Stage III epithelial ovarian cancer (n = 10), and ductal breast cancer ... been well established as an immunotherapeutic target antigen In fact, an anti-human CD52 antibody therapy, Alemtuzumab (Campath) has been developed and is FDA approved for the treatment of CD52 expressing ... interests The University of Michigan and RJB have submitted a patent regarding the use of Alemtuzumab as an anti-angiogenic agent in ovarian cancer This was submitted after the completion of the described...
  • 14
  • 728
  • 0
báo cáo hóa học:

báo cáo hóa học:" Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors" docx

Hóa học - Dầu khí

... within the extravascular compartment of early, less mature and smaller malignant brain tumor colonies, whether primary or metastatic Significance of the luminal glycocalyx layer of the BBTB of malignant ... Morris DE, Carey LA, Ladha AM, Brem S: Guidelines for the initial management of metastatic brain tumors: Role of surgery, radiosurgery, and radiation therapy JNCCN Journal of the National Comprehensive ... radiosurgery alone or in combination with whole brain radiotherapy compared to conventional surgery and/or whole brain radiotherapy for the treatment of one or more brain metastases: A systematic...
  • 14
  • 492
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc

Hóa học - Dầu khí

... one did, and in fact the task was well tolerated Furthermore, there was no degradation of performance at the end of the adaptation phase as compared to the final portion of the wash-out phase One ... target, and shifted it laterally, of three times the maximum lateral deviation observed in the average baseline trajectory The ‘average’ trajectory was the ‘average’ of all trajectories in the same ... treatments and at the overall effect of robot treatment over the whole duration of the trial Data Analysis Hand trajectories were sampled at 100 Hz The x and y components were smoothed with a...
  • 11
  • 596
  • 0
báo cáo hóa học:

báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx

Hóa học - Dầu khí

... parallel 1.8 mm Kirschner wires from the tip of the olecranon and a 18 gauge wire in a figure -of eight fashion Major intraoperative goal was the perforation of the ulnar Mayo Classification for ... Visual Analogue Scale (VAS) patient satisfaction score (b) the intramedullary pin The above hypothesis wasn't confirmed by Paremain et al [22] as the results of their biomechanical study indicated ... olecranon fracture Mayo Type IIA fracture of the left olecranon after a fall in a 52-year-old woman (A) Lateral (B) and anteroposterior radiographs (C) at years postoperatively showed signs of...
  • 6
  • 492
  • 0
báo cáo hóa học:

báo cáo hóa học:" Long-term follow-up on the use of vascularized fibular graft for the treatment of congenital pseudarthrosis of the tibia" pdf

Hóa học - Dầu khí

... years (at 19 years old) after the surgery The average term was 10.6 years and the average age was 18.3 years old It seemed to be characteristic that these pains appeared at late adolescence These ... was applied in cases and contralateral VFG was applied in cases, in which one was for the initial trial of VFG, and the other was for the second trial of VFG after failure of bone consolidation ... fibular graft which was secured by several screws End-to-end anasto- Statistical analysis Clinical data were statistically analyzed using the MannWhitney U-test for quantitative data of the term of...
  • 7
  • 502
  • 0
báo cáo hóa học:

báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot

Hóa học - Dầu khí

... T12 L1 L1 T11 T11 T11 L1 L1 T12 MVA MVA MVA MVA MVA MVA MVA MVA MVA Fall Fall MVA Fall MVA MVA Fall MVA MVA Fall MVA MVA Fall MVA MVA Fall MVA Fall Fall MVA MVA MVA FD UB UB UB UB UB UB UB UB TRS ... Additionally evaluation of pain scale for all the patients suggested that our fixation strategy had been successful in improving the pain scales at final follow-up and all the patients were able ... CI, Jane JA, Whitehill R, Wang GJ, Szabo TA, Hansen CA, Shaffrey ME, Chan DP: Surgical approaches for the correction of unstable thoracolumbar burst fractures: a retrospective analysis of treatment...
  • 6
  • 519
  • 1
báo cáo hóa học:

báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc

Hóa học - Dầu khí

... is a chance of intra-articular pin placement, causing septic arthritis and a risk of damaging the growth plate An external fixator is also used for the treatment of paediatric supracondylar fractures ... this article as: Lam et al.: The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report Journal of ... the site, the pattern of the fracture and its associated injury When treating the displaced supracondylar fracture, the traditional method of traction may fail due to the unbalanced pull of the...
  • 6
  • 438
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

Hóa học - Dầu khí

... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...
  • 7
  • 531
  • 0

Xem thêm