agricultural biodiversity a key element of ecosystem health and sustainable food security
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int J Radiat ... Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species not mediate NF-kappaB activation EMBO J 22, 3356–3366 Yang ... hypoxia and reoxygenation phases, typical of intermittent hypoxia, also stabilize HIF- 1a and activate HIF-1? In the absence of oxygen, HIF- 1a is rapidly stabilized, and short, intermittent hypoxia...
- 12
- 390
- 0
Tài liệu A sociology of mental health and illness Third edition pptx
... social capital and neighbourhood The relationship between poverty and mental health status Labour market disadvantage and mental health Housing and mental health Social class and mental health ... which are stable, certain or invariant In each case, the caveat of social relativism has to be registered Judgements about health and illness (physical as well as mental) are value laden and reflect ... Benjamin (who was a marginal and ambivalent Institute member) and Reich, a Marxist psychoanalyst and outsider These explorations had an explicit emancipatory intent and were characterized by anti-Stalinist...
- 290
- 1,551
- 1
Tài liệu Handbook of Ecological Indicators for Assessment of Ecosystem Health ppt
... integrated spatial simulation modeling; analysis of energy and material flows through economic and ecological systems; valuation of ecosystem services, biodiversity, and natural capital; and analysis ... by Akbari to analyze a nonagricultural and an agricultural ecosystem. 4 He found that the latter system, representing an ecosystem at an early stage, has a higher surface-canopy air temperature ... to a global dissemination of ecological modeling and ecological management of aquatic ecosystems, mainly lakes and wetlands Robert Costanza is Gordon Gund professor of ecological economics and...
- 464
- 1,113
- 1
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management ... threaten to disadvantage noncompliance Law is also similar to what Wiener and Doescher (1991)'term a structural solution, that is, a political act that mandates individual behavior For Taylor and Singleton ... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic...
- 14
- 780
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
- 12
- 454
- 0
Chart of Accounts: A Critical Element of the Public Financial Management Framework potx
... INTERNATIONAL MONETARY FUND Fiscal Affairs Department Chart of Accounts: A Critical Element of the Public Financial Management Framework Prepared by Julie Cooper and Sailendra Pattanayak Authorized ... legislature/parliament) is held accountable to parliament and the public at large, and the managers of individual government agencies are internally held accountable in terms of their legal mandate/responsibility ... budgetary revenue and expenditure operations.7 • Financial planning and management This includes financial planning, cash management, and asset and liability management From the perspective of COA...
- 27
- 654
- 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
... detail, a coupled optical assay was elaborated with alcohol dehydrogenase as auxiliary enzyme, catalysing the aldehyde–alcohol conversion similar to the assays established for pyruvate decarboxylase ... the program GNOMOKO [24] The molecular masses were calculated from the ratio of the forward scattering intensity of the samples and of the molecular mass standard BSA The volume fractions of monomers, ... GmbH) and ZmPDC (244 kDa) were used as molecular mass standards Small angle X-ray solution scattering with synchrotron radiation Data were collected on the X33 camera of the European Molecular Biology...
- 10
- 430
- 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
... C4 carbon signals in NMR analysis could be obtained below a certain degree of crystallinity and within a reasonable acquisition time, so that X-ray diffraction was used as an alternative to map ... showed no impact on the crystallinity of untreated Avicel Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quantifying the contribution of amorphous ... compilation ª 2010 FEBS 1575 Cellulose crystallinity M Hall et al A Fig Effect of crystallinity (obtained from X-ray diffraction data and multivariate statistical analysis) on the initial rate in Avicel...
- 12
- 554
- 0
HealtH education PrinciPles in Patient education: A literature review of selected health education principles used in patient education pdf
... multifaceted intervention so that individual parts interact To establish an overall educational approach and uniformity in all parts of patient education, also by way of participation and dialogue ... clearly defined roles of the health professional have to change Several people maintain that relational skills lie at the core of professional skills Collaboration between patient and health professional ... selfdetermination and clinical decision-making, 18 Health Education Principles in Patient Education organisation of healthcare services and clinical information systems, and resources and local community...
- 67
- 326
- 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot
... Brazil, France, Reunion Island Japan Spain Italy, Mexico, Poland, USA Brazil Japan Bulgaria, Canada, France, Germany, Greece, USA, Italy, Japan, Lebanon, the Netherlands, Poland, Russia, Spain, Switzerland, ... Switzerland, Turkey, UK, USA, Vietnam Russia Japan UK Brazil Brazil Czech Republic Croatia Spain Italy Italy, UK Italy Bulgaria Croatia Italy Brazil, France, Reunion Island, Spain Germany Leiden ... Kume H, Kawamura Y, Kanzawa N, Nakauchi Y, Kimura S, Kawashima S & Maruyama K (1993) A novel domain sequence of connectin localized at the I band of skeletal muscle Skeletal muscle calpain 32 33...
- 10
- 350
- 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki H (1990) Molecular cloning of the Bombyx mori prothoracicotropic hormone Science 247, 1333–1335 Adachi-Yamada T, Iwami ... Biosciences, Palo Alto, CA, USA) Reporter gene analysis Four days after injection with recombinant AcNPV, the brain–SG complex of larvae and pupae was dissected out in NaCl ⁄ Pi and mounted onto a hole-slide ... the mean pixel fluorescence for the entire somata (S) of the brain Fluorescence images were converted to grayscale and inverted into black and white images An area adjacent to the area of interest...
- 10
- 437
- 0
THE EFFECTIVENESS OF WORK HEALTH AND SAFETY INTERVENTIONS BY REGULATORS A LITERATURE REVIEW
... change safety practice by encouraging safe and healthy behaviours and discouraging unsafe and unhealthy behaviours through the use of positive and negative incentives “carrots and sticks” approach ... understanding how sub group differences within small business can influence awareness of regulations Addison and Burgess found that awareness of and understanding the area of application of manual ... with a sample of UK food manufacturers and retailers Henson and Heasman found that the decision to comply was not based on a calculation of the relative costs and benefits of compliance and non-compliance...
- 83
- 697
- 0
báo cáo hóa học:" Health-related quality of life in a clinical sample of obese children and adolescents" pptx
... standards Acta Paediatrica 2005, 94:496-498 Meltzer H, Gatward R, Goodman R, et al: Mental Health of Children and Adolescents in Great Britain HMSO, London; 2000 Stansfeld SA, Haines MM, Head JA, ... Cite this article as: Riazi et al.: Health- related quality of life in a clinical sample of obese children and adolescents Health and Quality of Life Outcomes 2010 8:134 Submit your next manuscript ... Patel for assistance with data collection, and Professor Michael Healy for statistical advice This study was supported by the Royal Holloway Research Strategy Fund Author details Department of Psychology,...
- 6
- 375
- 0
Báo cáo y học: "Balance between survivin, a key member of the apoptosis inhibitor family, and its specific antibodies determines erosivity in rheumatoid arthritis" ppt
... mortality of patients with rheumatoid arthritis J Rheumatol 2000, 27:2283-2284 30 Kamihira S, Yamada Y, Hirakata Y, Tomonaga M, Sugahara K, Hayashi T, Dateki N, Harasawa H, Nakayama K: Aberrant expression ... MR, Haemel AK, Wood GS: Apoptosis and melanoma: molecular mechanisms J Pathol 2003, 199:275-288 Hasunuma T, Kayagaki N, Asahara H, Motokawa S, Kobata T, Yagita H, Aono H, Sumida T, Okumura K, ... Double-wave reading at 450 and 570 nm was used and the difference of absorbances was calculated The obtained absorbance values were compared with the serial dilution of recombinant survivin and are...
- 10
- 505
- 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads ... in Material and methods, days after transfection (a) For inhibition of the miR-30 family, RNA was extracted and analyzed at day 10 of differentiation (b) For over-expression of pre-miR3 0a and ... RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacturer’s protocol Real-time PCR was...
- 13
- 365
- 0
báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx
... The data set was made up of data from eight repetitions of each ripening stage of RH and RHB The variable set was made of the major 41 volatile aroma compounds PCA involves a mathematical procedure ... developmental and genetic cues, and pointed out the central role of carotenoid cleavage dioxygenases, namely the product of ccd4, in flesh color and peach aroma formation By taking advantage of a wild ... designed and participated to molecular experiments and data analysis, and contributed to manuscript writing; GH and ET performed carotenoid extractions, HPLC and data analyses; GG contributed early...
- 14
- 303
- 0
Handbook of Ecological Indicators for Assessment of Ecosystem Health - Chapter 1 pot
... Stockholm Water Prize for his outstanding contribution to a global dissemination of ecological modeling and ecological management of aquatic ecosystems, mainly lakes and wetlands Robert Costanza is ... Basis for EHA References Appendix A Chapter Application of Ecological Indicators to Assess Environmental Quality in Coastal Zones and Transitional Waters: Two Case Studies J.C Marques, F Salas, ... Multi-Scale Resilience Estimates for Health Assessment of Real Habitats in a Landscape G Zurlini, N Zaccarelli, and I Petrosillo 13.1 13.2 Introduction Rationale 13.2.1 Ecological Phases, States, and...
- 18
- 382
- 0
Handbook of Ecological Indicators for Assessment of Ecosystem Health - Chapter 2 ppsx
... Indicator level Chapter Ecosystem 10 11 12 13 14 15 16 Coastal, estuary Lake Lake Coastal Coastal Marine Wetland Pond, lagoon, lake, basin Agroecosystem Landscape Landscape Regional Regional River ... used as an indicator for a healthy forest ecosystem and a high annual growth of a selected population may be used as an indicator for a healthy environment A high mortality in a population can, ... combinations of that set of characteristics are what Fauchald and Jaumars term ‘‘feeding guilds.’’71 Authors such as Maurer et al.75 and Pires and Muniz76 have tried the use of ´ the classification of...
- 62
- 511
- 0
Handbook of Ecological Indicators for Assessment of Ecosystem Health - Chapter 3 docx
... Table 3.2 Application of indices as a function of data requirements and data availability Data availability Qualitative data Quantitative data Metadata Rough data Indicators ShannonWienner Margalef ... of selecting the most adequate ecological indicators as a function of data requirements and data availability In the process of selecting an ecological indicator, data requirements and data availability ... The application of a given ecological indicator is always a function of data requirements and data availability Therefore, in practical terms, the choice of ecological indicators to use in a particular...
- 38
- 329
- 0
Handbook of Ecological Indicators for Assessment of Ecosystem Health - Chapter 5 doc
... minimum EHI of 12 Of 30 lakes, 20 had a ‘‘middle’’ health status, lakes had a ‘‘bad’’ health status, lakes had a ‘‘worst’’ health status, and only one lake had a ‘‘good’’ health status Table 5.8 ... ‘‘Regional Differentia and its Mechanisms for the Ecosystem Health of Large Shallow Lakes’’; and ‘‘Assessment and Management of Watershed Ecosystem Health. ’’18 So far, a number of indicators have ... lake ecosystem health status Therefore, BA and Chl -a can service as two basic indicators According to data availability for Italian lakes, BA are selected as a basic indicator; while zooplankton...
- 35
- 401
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25