after a global variable is initialized top you can use it anywhere notice that in the example statement bottom which calculates the final velocity vfinal based on gravityconstant and two more variables called vinitial and my
Tài liệu UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 1. WHY YOU SHOULD USE THIS MODULENOTE docx
... communities as facilitators of knowledge and information exchange What is an online community Traditionally, the communities that we worked in and that we learned from were principally confined ... thinks an online community would be a great opportunity … Benefits of an online community Alice is the Managing Director of the Regional Association for Sustainable Agriculture (RASA) RASA’s mission ... information sharing; and • be able to create and implement a plan to use electronic networking with other media to improve communication, information sharing and learning among communities and peer...
- 21
- 402
- 0
a beginner’s introduction to computer programming you can do it!
... (an object with a value that can vary) called count whose type is int The in parentheses is called an initializer and it provides the initial value for count, zero in this case Because int is ... comments with your name and the date at the top (or if you prefer, at the bottom) of the file It is easy to underrate the value of making sure that a file contains its last modification date and its author’s ... express intentions in a way that a computer can use, and that it isn’t at all weird It isn’t English though there is a scattering of English words in it It is a computer language called C++ (pronounced...
- 380
- 730
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
... have a connection with the top quark This thesis focuses on studies on the top quark, taking advantage of its interesting position in the Standard Model to explore its relation to the strong interaction ... calculating approximately the probabilities for parton splitting into more partons at all orders in perturbation theory The parton shower calculation is valid in the collinear approximation, in which the ... modifications, is also used to simulate initial state radiation, before the interaction, since there are also quark and gluon splittings at that stage The Pythia [50] 10 implementation of the parton...
- 251
- 712
- 0
42 TELESALES TIPS YOU CAN USE RIGHT NOW TO GET MORE BUSINESS AND AVOID REJECTION
... take action and make a decision, based almost solely on the words and ideas that come from your mouth It' s quite an awesome feat when you think about it And think about it It takes a talented individual ... for them What are you now doing/using/buying in that area?" GETTING COMMITMENT (Closing) 28.This is not the major event in a telemarketing sales call It' s the natural, logical, validation of the ... to take advantage of; mention that you were "thinking of them" and tell them why One of my printing salesmen called to say he "just came back from a trade show and saw something interesting, and...
- 14
- 856
- 0
A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA
... coherence with a context) Discourse analysis is an important and discipline which has attracted the interest and concern of many linguists and researchers context, topics, information structure and ... to the Academy Awards when the world is in such turmoil? Because art is important And because you believe in what you and you want to honor that [138] The noticeable thing to emerge in EOASs is ... found in this study In these cases, the speaker sets a subject position for himself as an individual the award winner One interesting thing is that the speaker used the great majority of Personal...
- 13
- 851
- 1
Reputation Why it matters and how you can manage it
... television, radio and online adverts to posters, packaging and collateral materials that everyone always sees Your brand is your public face Reputation, on the other hand, is the internal execution ... management decisions; both in the lead-up and the response to the reputational crisis that arose Simply stated: reputation is a management issue – it can be measured and managed in any direction ... such, its definition and quantification can and need to be incorporated into both strategic and operational planning and oversight • Assessed correctly, reputation is an innovation driver and can...
- 16
- 403
- 0
About sugar buying for Jobbers How you can lessen business risks by trading in refined sugar futures pptx
... business and personnel, with the result that the two organizations work in harmony virtually as partners, confusion and misunderstandings are avoided, quicker and more advantageous transactions ... location in connection with the beet sugar industry also makes it highly desirable Its situation in regard to the offerings of the Louisiana producers is also an additional protection and advantage ... be any profit at all By conservative, wise use of the Sugar Exchange, most of this risk and uncertainty can be eliminated and both you and your customer can go ahead with your plans with your...
- 23
- 371
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
... DdesA mutant complementation A 4204-bp ScaI fragment containing the desA coding region was cloned into the pBluescript SK EcoRV site As the DdesA mutant is apramycin resistant, the kanamycin resistance ... a disruption cassette containing the apramycin resistance gene [aac(3)IV] and oriT was used as template The mutant was constructed using the oligonucleotides 5¢-acccc tctcggaccgtccccaccggaggacccccccatgATTCCGGGGATC ... RT-PCR analysis, and there is overlapping of the desB translation termination triplet with the ATG of desC and also of desC and desD (so -called translational coupling); moreover, there are no intergenic...
- 13
- 456
- 0
Leadership the Hard Way: Why Leadership Can’t Be Taught and How You Can Learn It Anyway
... delicate balance Take an example that is top of mind for so many people today the fear of terrorism In my opinion, many political leaders in both the United States and Israel aren’t containing fear ... go too far When an organization is in a crisis, lack of resistance can itself be a big problem It can mean either that the change you are trying to create isn’t radical enough and is therefore ... because nobody wants to fail So leaders have to master a delicate balancing act On the one hand, they must acknowledge the inevitable fear that survival situations engender; admit that, in a turbulent...
- 157
- 586
- 0
GUIDANCE TO INSTITUTIONS AND ACCREDITING AGENCIES REGARDING A CREDIT HOUR AS DEFINED IN THE FINAL REGULATION PUBLISHED pdf
... and learning outcomes for academic and other non-Federal purposes, so long as it is also awarding Federal student aid using the credit hour definition in the regulations An institution may have ... the agency is an institutional accrediting agency and its accreditation or preaccreditation enables those institutions to obtain eligibility to participate in title IV, HEA programs, the agency ... taking an exam, an interactive tutorial, or computer-assisted instruction; attending a study group that was assigned by the institution; contributing to an academic online discussion; and initiating...
- 15
- 301
- 0
Working pAper series no 1041/ A pril 2009: An economic cApitAl model integrAting credit And interest rAte risk in the bAnking book doc
... in a consistent fashion The way credit and interest rate risk are modelled individually is in line with standard practices The credit risk component is based on the same conceptual framework as ... Basel II and the main commercially available credit risk models Interest rate risk, on the other hand, is captured by earnings at risk, the approach banks use traditionally to measure this risk ... Traditionally it would be argued that the sum of economic capital set against credit risk and interest rate risk separately is a conservative upper bound in comparison to economic capital set against...
- 57
- 1,186
- 0
Cartoon Clouds You Can Use docx
... Here are four different examples of cartoon clouds that you can use in your own drawings I think the shapes are easy enough and it' s not worth writing a full tutorial about this topic because it' s ... drawing like this it' s good to keep in mind that you want to keep them as simple and clean as possible Example - Another Decorative Cloud These clouds are drawn the same way as the ones in the ... this in the video game Zelda: The Wind Walker and I thought that they were really cool Actually the entire style of the game is totally awesome and if you haven't played this one I suggest you...
- 4
- 304
- 0
402Part II: SQL and SQL*PlusWithin the into table clause, you can use the recnum keyword to pps
... remote database via a database link The account that the database link uses in the remote database must have access to the tables and views used by the database link You cannot create a materialized ... when that link is used, it will attempt to open a session in the remote database that has the same username and password as the local database account This is called a default login, since the username/password ... Business rules may change, forcing additional changes Database structures and space availability may change, further affecting your ability to load the data In an ideal case, a data load will either...
- 105
- 472
- 0
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
... the manuscript Additional files 12 13 The following Additional files are available online: Additional file An Word file containing a table that shows a table of all SNPs evaluated for association ... stratified analyses are based on the same SNPs and samples as the initial analysis and can therefore not be considered to be independent from each other Nonetheless, in order to obtain an indication ... modulates the affected disease pathway so that it mainly influences the clinical disease in RF-negative RA, specifically in men However, it is not impossible that this pathway play a role also in...
- 11
- 475
- 0
báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx
... ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg), with capitals indicating ERS1 sequence and parentheses indicating T-DNA left border sequence This mutation was named ers1-3 to differentiate it from ... Identification and genetic analysis of T-DNA insertion mutant alleles in ERS1 and ETR1 Both ers1-3 and etr1-9 were isolated from Wisconsin Basta population at the Arabidopsis Knockout Facility at the ... insertion, and ETR1-3'F (5' CATACCGAAAGTTCCAGCCATTC 3') and ETR1-3'R (5' CAAGCATCCATAACTCGATCCAAATTC 3') for amplification of a product 3' to the site of the T-DNA insertion After 25 cycles, the...
- 15
- 393
- 0
Báo cáo y học: "Evaluation of the effects of a VEGFR-2 inhibitor compound on alanine aminotransferase gene expression and enzymatic activity in the rat liver" pdf
... activity of ALT, AST, and ALP suggesting that AG28262 induces hepatic injury Clinical chemistry data demonstrated a statistically significant increase in serum ALT, ALP activities, and increased ... potential distribution of drugs and toxins may help in understanding the potential localization of hepatic diseases and carcinomas within the liver Understanding these regional effects is critical in ... RNA using the Retroscript kit (Ambion; Austin, TX) For detecting gene expression of alanine aminotransferase (ALT), the following primers were used: 5’TTCAAGCAGAGAGACAGGAG-3’ and 5’-TGAGGGAAGGAATACATGG-3.’...
- 7
- 339
- 0
Office VBA Macros You Can Use Today phần 1 docx
... situations The average user may find 10 or more macros that they can begin using instantly, while others may find that they can implement half the macros in this book within a few days What is VBA? ... technical books We have attempted to organize it so that someone reasonably familiar with an application can go to the chapter for that application, start reading, and begin using the automation ... Introducing the Visual Basic Editor The VBE window is just like any other window It has a Title bar, a Menu bar, and a Tool bar, and likely contains some familiar options or icons, and some that you...
- 46
- 363
- 0
Office VBA Macros You Can Use Today phần 2 ppsx
... developing an application in Excel, it is commonly necessary to give the user an interface with which to interact Building a toolbar is an easy way to that because it is familiar to them and gives the ... updating¶ Application.ScreenUpdating = False¶ 'Store current calculation method in variable OldCalculation = Application.Calculation¶ 'Set calculation to manual¶ Application.Calculation = xlCalculationManual¶ ... Range, _¶ ByVal criteriaColor As Range) As Variant¶ 'Variable declaration¶ Dim Rng As Range¶ 'Make it volatile - automatic calculation¶ Application.Volatile True¶ 'Validations, only one area¶...
- 45
- 359
- 0
Office VBA Macros You Can Use Today phần 3 ppt
... Excel is used Almost all applications can create a text file that can be imported into another application so that application can use the information to some other purpose In almost every case, there ... tables based on the same database, displaying the information in a different way can become a real hassle There is no way in Excel to "lock" the Page fields of pivot tables to display the same ... through the Toolbars and save the ones that are visible¶ For Each Bar In Application.CommandBars¶ If Bar.Type = msoBarTypeNormal Then¶ If Not Bar.Name = BarName Then¶ If Bar.Visible Then¶ 'Save the...
- 45
- 325
- 0
Office VBA Macros You Can Use Today phần 4 pot
... Function DoubleBackslashes(s As String) As String¶ 'Variable declaration¶ Dim newString As String, startPos As Long, endPos As Long¶ startPos = 1¶ 'Locate each backslash and insert an additional one¶ ... with Caption With this procedure, you can insert a picture, format it with text wrapping, and add a caption Scenario: Inserting pictures into Word and adding a caption involves a number of individual ... formatted dark gray and every second row light gray The text is formatted white in the dark gray regions; black otherwise This formatting is applied by the procedure 'FormatCalendar' and can be adjusted...
- 45
- 328
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25