advanced c programming in linux pdf
Tài liệu Advanced Linux Programming: 1-Advanced UNIX Programming with Linux pdf
Ngày tải lên :
21/01/2014, 07:20
... Makefile contains:
reciprocal: main.o reciprocal.o
g++ $(CFLAGS) -o reciprocal main.o reciprocal.o
main.o: main .c reciprocal.hpp
gcc $(CFLAGS) -c main .c
reciprocal.o: reciprocal.cpp reciprocal.hpp
g++ ... produce a program called
reciprocal.
4
This program will compute the reciprocal of an integer.
Listing 1.1 (main .c) C source file—main .c
#include <stdio.h>
#include “reciprocal.hpp”
int main ... the command prompt compiles the main .c
source file:
% gcc -c main .c
The resulting object file is named main.o.
The C+ + compiler is called g++. Its operation is very similar to gcc; compiling
reciprocal.cpp...
- 16
- 439
- 0
David haskins c programming in linux
Ngày tải lên :
19/03/2014, 14:07
...
Introduction
The teaching approach
I began university teaching later in life after a career programming in the telecommunications industry.
My concern has been to convey the sheer fun and creativity ... array of pointers to character
strings called argv[].
Download free books at BookBooN.com
C Programming in Linux
8
Introduction
Introduction
Why learn the C language?
Because the C language ... BookBooN.com
C Programming in Linux
5
Contents
3. Functions, pointers and structures
3.1 Functions
3.2 Library Functions
3.3 A short library function reference
3.4 Data Structures
3.5 Functions,...
- 84
- 318
- 0
Tài liệu Adding Users in Linux pdf
Ngày tải lên :
21/12/2013, 19:15
... Instructor,
Windows
Computer
B2 studentB2 studentB2
B3 studentB3 studentB3
B4 studentB4 studentB4
C1 instructorC1 instructorC1 Instructor,
Linux Computer
C2 studentC2 studentC2
C3 studentC3 ... Systems, Inc.
Lab 10.2.2: Adding Users in Linux
Estimated Time: 20 minutes
Objective
In this lab, the student will learn how to create user accounts using the Linux Red Hat 7.X
operating system. ...
Briefly describe the output of this command?
Verify that the accounts were created correctly in step 4. Randomly pick six accounts and
use the finger command to see if they were created correctly,...
- 7
- 334
- 0
Tài liệu Creating Directories in Linux pdf
Ngày tải lên :
18/01/2014, 05:20
... screen.
2. Next, create another directory in the chemistry directory, type:
cd chemistry
This will change the current working directory to the chemistry directory. From the
chemistry directory, ... Lab 10.3.1 Copyright 2002, Cisco Systems, Inc.
Step 3: Creating Directories
1. The following command sequence will not work unless the user is in the home
directory. Type:
cd
Verify that ...
cd
Verify that the user is in the home directory by using the pwd command. Next, create the
directory structure by typing in the following command:
mkdir –p chemistry/experiments/week3
Example...
- 3
- 339
- 0
Tài liệu Practical C Programming Third Edition pdf
Ngày tải lên :
14/02/2014, 20:20
... generic cc compiler or the Free Software Foundation’s gcc
compiler. For MS-DOS/Windows users, instructions are included for Borland C+ +,
Turbo C+ +, and Microsoft Visual C+ +. (These compilers compile ... of many
chapters, you will find a section called Programming Exercises.” These sections
contain exercises that might be used in a programming class to test your knowl-
edge of C programming.
Notes ... entry for information on how to get their software.)
Among their offerings is a C compiler called gcc.
To compile a program using the gcc compiler use the following command line:
% gcc -g -Wall...
- 456
- 3K
- 7
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
Ngày tải lên :
30/03/2014, 04:20
... following prim-
ers: 5Â-GCTTCAGCTGGGATCCGGTGGTATGGTGA G
CAAGG-3Â; and 5Â-CCAGATCGCGGCCGCTTAGTGG
TGATGATGGTGGTGATGATGCTTGTACAGCTCGT
CC-3Â. Following the His
8
-tag, a TAA stop codon was
inserted in ... primer,
5Â-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC
GAA-3Â; 2.5T sense primer, 5Â-GCGCAAGCGCTTACG
ACTTAAAAAAATTGGTCAGAAAATCCAGG-3Â; 2.5T
antisense primer, 5Â-CCTGGATTTTCTGACCAATTTTT
TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense ... primers
5Â-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG
GAGC-3Â and 5Â-CCAGATCGCGGCCGCCTTGTACAG
CTCGTCATGCCGAGAG-3Â; EcoRI and ApaI restriction
enzyme sites were introduced into the 5Â-end and 3Â-end of
the Cerulean DNA fragment....
- 16
- 329
- 0
guide to assembly language programming in linux 2005
Ngày tải lên :
04/04/2014, 22:21
... edge.
A clock cycle is defined as the time between two successive rising edges as shown in Fig-
ure 2.26. You can also treat the period between successive falling edges as a clock cycle.
Clock rate ... same clock period.
a global definition of time instants at which changes can take place. Implicit in this definition is
the fact that the clock signal also specifies the speed at which a circuit ... associated I/O controller
78 Assembly Language Programming in Linux
Summary
We described the Intel IA-32 architecture in detail. Implementations of this architecture include
processors such as Pentium,...
- 539
- 366
- 0
Tài liệu Advanced Linux Programming: 3-Processes pdf
Ngày tải lên :
26/01/2014, 07:20
... 60
Chapter 3 Processes
Listing 3.7 (sigchld .c) Cleaning Up Children by Handling SIGCHLD
#include <signal.h>
#include <string.h>
#include <sys/types.h>
#include <sys/wait.h>
sig_atomic_t ... status;
}
int main ()
{
/* Handle SIGCHLD by calling clean_up_child_process. */
struct sigaction sigchld_action;
memset (&sigchld_action, 0, sizeof (sigchld_action));
sigchld_action.sa_handler ... example in which the ls command is
invoked twice and its exit code is displayed after each invocation. In the first case, ls
executes correctly and returns the exit code zero. In the second case,...
- 16
- 425
- 0
A Complete Guide to Programming in C++ part 9 pdf
Ngày tải lên :
06/07/2014, 17:21
... minimum field width to n
Returns the fill character used
Sets the fill character to ch
int width() const;
int width(int n);
int fill() const;
int fill(int ch);
Manipulator Effects
Sets the minimum ... Declaration of cin, cout
#include <iomanip> // For manipulators being called
// with arguments.
#include <string>
using namespace std;
int main()
{
int number = ' ';
cout ... generates octal, decimal, and hexadecimal output.
#include <iostream> // Declarations of cin, cout and
using namespace std; // manipulators oct, hex,
int main()
{
int number;
cout <<...
- 10
- 615
- 1
A Complete Guide to Programming in C++ part 20 pdf
Ngày tải lên :
06/07/2014, 17:21
... left curved bracket indicates the start of a function block, which contains the state-
ments defining what the function does.
ᮀ Prototype and Definition
In a function definition the function ... settings for program com-
pilation.
DEFINING FUNCTIONS
■
175
The following section describes how to program global functions. Chapter 13, Defining
Classes, describes the steps for defining member ... of inheritance to create specialized classes without needing to
change any existing classes.
When implementing a class you must define the capacities of those objects, that is,
the member functions,...
- 10
- 517
- 0
A Complete Guide to Programming in C++ part 26 pdf
Ngày tải lên :
06/07/2014, 17:21
... manipulates a local copy.
Thus, only a local copy of the string is changed in the function, but the string in
the calling function remains unchanged.
Exercise 2
//
// circle.cpp
// Defines and calls the ... Defines and calls the function circle().
//
#include <iostream>
#include <iomanip>
#include <string>
using namespace std;
// Prototype of circle():
void circle( const double& ... function strToUpper() is
declared as a
string& instead of a string?
Exercise 2
Write a void type function called circle()to calculate the circumference and
area of a circle.The radius and two...
- 10
- 415
- 0
A Complete Guide to Programming in C++ part 27 pdf
Ngày tải lên :
06/07/2014, 17:21
... account.h
// Defining the class Account.
//
#ifndef _ACCOUNT_ // Avoid multiple inclusions.
#define _ACCOUNT_
#include <iostream>
#include <string>
using namespace std;
class Account
{
private: ... external access, and the public members of that class. An applica-
tion program accesses objects by using the public methods of the class and thus activat-
ing its capacities.
Access to object data ... following example includes a class named Account used to represent a bank
account. The data members, such as the name of the account holder, the account num-
ber, and the account balance, are declared...
- 10
- 374
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2