0

adrenocortical axis as a gastroprotective component of stress response

Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Báo cáo khoa học

... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... species of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly ... methods have been tried (baiting at the base of cashew trees and engine oil spray around tree base), but this only resulted in a temporary reduction of ghost ants This was mainly because grass and...
  • 10
  • 551
  • 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4

Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

Báo cáo khoa học

... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals ... community baseline surveys A total of major cashew-growing provinces, which have 300,700 of cashew, accounting for 86% of the total cashew areas in Vietnam will be targeted Progress to Date Based on ... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained...
  • 12
  • 531
  • 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam

Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf

Báo cáo khoa học

... are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that ... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22% by men The women have had an average ... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 212 cashew farmers were...
  • 7
  • 400
  • 0
Project Technical Report:

Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

Báo cáo khoa học

... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals ... identification of weaver ant colonies, transplantation of the ants into cashew orchards, and management and maintenance of the weaver ant colonies Under the supervision of Dr Peng, they have also gained ... to make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages and disadvantages of...
  • 24
  • 453
  • 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7

Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

Báo cáo khoa học

... orchard, due to the sideeffect of ghost ant baiting, weaver ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much ... ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster sp) and an unidentified black ant in this orchard, but we did not bait ... orchard Fig Average abundance of weaver ants in the IPM plot at Hong Loc Centre, Dong Nai province, Vietnam % weaverv ant abundance Fig shows that weaver ant abundance was over 60%, and the ant...
  • 26
  • 491
  • 0
Project Progress Report:

Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

Báo cáo khoa học

... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... showed that all the TOT trainees (56 in the first year and 56 in the second year) successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training ... X and cultivation Mr DV Tu IAS Cashew cultivation X X Mr DD Hien IAS Fertilizer application X X Mr HX IAS Cashew diseases and X X Quang their control Dr DT Binh IAS Cashew cultivation X Ms NT...
  • 10
  • 302
  • 0
Nghiên cứu khoa học nông nghiệp

Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

Báo cáo khoa học

... lphlan@yahoo.com 2 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 2002, ... net profit was achieved in the ICI plots A manual about the integrated cashew improvement (ICI) program using weaver ants as a major component has been developed for ICI program trainers and extension ... integrated cashew improvement (ICI) program using weaver ants as a major component - Manual for ICI program trainers and extension officers in Vietnam” has been developed The manual includes • cashew...
  • 37
  • 394
  • 0
Collaboration for Agriculture & Rural Development:

Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

Báo cáo khoa học

... started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration orchards has ... important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect of these two species of ants on cashew flushing shoots damaged by the three major ... preparation of cashew IPM posters; 113 of insect pests, 47 of natural enemies, of diseases and 10 of orchard management A detailed selection of these photos will be made after we have comments and...
  • 10
  • 327
  • 1
báo cáo khoa học:

báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

Báo cáo khoa học

... phenotypes, and acts antagonistically to suppress ABA-mediated responses As ABA is a central regulator of plant adaptation to drought [30,31] and plays a crucial role in the regulation of transpirational ... Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring the expression profiles of ... NRP-B, an ubiquitin-associated (UBA) protein homolog and NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved in a variety...
  • 14
  • 254
  • 0
Báo cáo y học:

Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx

Báo cáo khoa học

... 5'-GAACAACATGCATTCCGAGAAG-3' Forward: 5'-GCGCAGCGCGTTGAA-3' Probe: 5'-AACGAACAGTCATCACCACATCTCATCCAG-3' Reverse: 5'-GGATGGAGCTCGTCCAAGTG-3' Forward: 5'-GCCATCCTGACTATTTCACTGAAGA-3' Probe: 5'-AAGCCTACTTTTTCTCAAGGGCAGTCACCG-3' ... 5'-GGCATCCTCGCCCAATTT-3' Forward: 5'-CCATGTGGCCTTCTACTTTGC-3' Probe: 5'-CCCCCCATCATTGGAGCTGTCATC-3' Reverse: 5'-TGCATCAGAGGGACGAAGAAA-3' Forward: 5'-TCCGAGCAGAAATCCAATCG-3' Probe: 5'-TTGGGACACATCCCGGGCACC-3' ... used as an internal control Statistical analysis All statistical analyses were done using StatView software (SAS Institute Inc., Cary, NC, USA) Data were analyzed using one-way analysis of variance...
  • 10
  • 378
  • 0
Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

Tổng hợp

... 80 and 100 µM standards were used 2.2.11 Homovanillic acid (HVA) assay This is a peroxidase-based assay using homovanillic acid (HVA; Mr = 182.18) as the oxidizable substrate (Fig 3.10) HVA was ... Oxidation of HVA in the presence of HRP to a fluorescence dimer 69 3.11 A standard calibration plot for the HVA assay 70 3.12 A standard calibration plot for the HPAA assay 74 3.13 Structure of ABTS ... ascorbic acid quenchers (AAQs) 130 xi LIST OF ABBREVIATIONS AND KEYWORDS AA Ascorbic acid AAQ Ascorbic acid quencher ABTS 2,2’-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid AscH- Ascorbate CuZnSOD...
  • 165
  • 397
  • 0
Báo cáo y học:

Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Y học thưởng thức

... Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure PROC GENMOD (SAS ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... Sickness absence can be viewed as an integrated measure of physical, psychosocial, and social function and wellbeing [5-7] As such, sickness absence levels can reflect an increased risk of developing...
  • 6
  • 578
  • 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Sức khỏe phụ nữ

... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...
  • 14
  • 610
  • 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
  • 12
  • 454
  • 0
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf

TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf

Sức khỏe giới tính

... Gradually in weeks he was able to maintain 90% oxygen saturation (SaO2) at room air Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO2) of 94% at ... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF and is associated with very high mortality...
  • 7
  • 352
  • 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học

... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization...
  • 10
  • 483
  • 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Báo cáo khoa học

... regions has also suggested that NF-jB might be regarded as a signal transducer that transmits transient synaptic signals to the nucleus and has a role in behaviour, learning and memory formation ... kinase A ⁄ CREB signalling Mol Cell Biol 26, 2936–2946 Kassed CA, Willing AE, Garbuzova-Davis S, Sanberg PR & Pennypacker KR (2002) Lack of NF-kappaB p50 exacerbates degeneration of hippocampal ... A, Benarese M & Spano PF (2005) Inhibition of IkappaBalpha phosphorylation prevents glutamate-induced NF-kappaB activation and neuronal cell death Acta Neurochirurgica Suppl 93, 59–63 Aleyasin...
  • 9
  • 527
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học

... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... carried out as described by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed...
  • 8
  • 426
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot

Báo cáo khoa học

... syntactic category aspect of each meaning of a phonetic word is also a part of the grammatical representation where i t makes associations with other syntactic categories The associations ... meanings, grammar, and pragmatic or local context, receive support as separately definable knowledge within studies of aphasia There is a vast l i t e r a t u r e concerning what aspects of language ... neurolinguistic l i t e r a t u r e demonstrates that the grammar can be affected in isolation from other aspects of language function (Cf Studies of agrammatic and Broca's aphasia as described in Goodenough,...
  • 9
  • 379
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx

Báo cáo khoa học

... statistic indicates the extent to which each surprisal estimate accounts for RT, and can thus serve as a measure of the psychological accuracy of each model However, this kind of analysis assumes ... Brian Roark, Asaf Bachrach, Carlos Cardenas, and Christophe Pallier 2009 Deriving lexical and syntactic expectation-based measures for psycholinguistic modeling via incremental top-down parsing ... surprisal as fixed factors in the baseline) are reported Figure shows the psychological accuracy of each model (χ2 (2) values) plotted against its linguistic accuracy (i.e., its quality as a language...
  • 11
  • 605
  • 0

Xem thêm