0

add a dom node to the document

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

Khoa học xã hội

... approaches the learner as a user of language rather than as a learner of language 1.2.3.3 A learning centered approach According to Hutchinson and Water (1987:72), “we would reject the term a ... functional syllabus is considered as belonging to analytic approaches as the starting point is not the linguistic items to the taught (as in synthetic approach) It is rather the behavioral organization ... the teachers of the objective they have to reach at the end of each unit and to encourage teachers to find suitable teaching methods Objectives, at the same time, enable teachers to arrange appropriate...
  • 43
  • 591
  • 1
A Gentle Introduction to the - Spring Framework

A Gentle Introduction to the - Spring Framework

Kỹ thuật lập trình

... each pool The application will also automatically create a calendar for each court that’s available during the course of the tournament and manage the many other variables of a tournament Track ... matchDao.setDataSource(dataSource); DefaultTournamentMatchManager tournamentMatchManager = new DefaultTournamentMatchManager(); tournamentMatchManager.setMatchDao(matchDao); new SwingApplication(tournamentMatchManager); ... class SwingApplication { private TournamentMatchManager tournamentMatchManager; public SwingApplication(TournamentMatchManager tournamentMatchManager) { this.tournamentMatchManager = tournamentMatchManager;...
  • 22
  • 501
  • 1
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

Sức khỏe trẻ em

... Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner et al (2008) report the same participants, as Calsbeek and colleagues in their ... longitudinal? Sub-total Sample and measures Response rate satisfactory? Sampling source appropriate? Are participants sampled to minimise bias? Use of valid and reliable paper and pencil measures a Sub-total ... (whether undiagnosed or failing to adhere to treatment) is failure to thrive, malabsorption and persistent diarrhoea Other symptoms include depression, abdominal pain, anaemia, arthritis, delayed puberty,...
  • 171
  • 709
  • 0
Tài liệu The Turner Review: A regulatory response to the global banking crisis pdf

Tài liệu The Turner Review: A regulatory response to the global banking crisis pdf

Ngân hàng - Tín dụng

... profits And the market capitalisation of financial companies, and in particular banks, grew as a % of GDP and as a % of total market capitalisation (Exhibit 1.29) This growth appears to be at variance ... regulation – in the US, the UK and increasingly across the world – has been that financial markets are capable of being both efficient and rational and that a key goal of financial market regulation ... 1.12: Trading book assets & capital 2007: examples Market risk capital requirement as % trading assets Trading assets as % of total assets Trading / market risk capital as % total capital requirements...
  • 126
  • 386
  • 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Báo cáo khoa học

... YjbV fragment peaks The ‘) 20 ’ after the molecular mass value signifies that the main component ion of the most abundant isotopic peak contains 20 13C atoms and has this mass value of identification ... the top-down approach deserve consideration for important proteomics research Acknowledgements We thank Barbara Baird, Ian Jardine, Neil Kelleher, Harold Scheraga and Klaas van Wyck for valuable ... protonated side chains of basic residues, in solution are solvated out into the aqueous phase, while in the gas phase they are instead solvated onto the protein backbone, with this apparently favored...
  • 13
  • 572
  • 0
Tài liệu BIOINSPIRED CHEMISTRY FOR ENERGY A WORKSHOP SUMMARY TO THE CHEMICAL SCIENCES ROUNDTABLE pptx

Tài liệu BIOINSPIRED CHEMISTRY FOR ENERGY A WORKSHOP SUMMARY TO THE CHEMICAL SCIENCES ROUNDTABLE pptx

Cao đẳng - Đại học

... which means they gather about twice as many of the available photons, they are probably more efficient at water oxidation than photosynthesis Moore highlighted several projects at Arizona State University ... Postdoctoral Associate Tina M Masciangioli, Responsible Staff Officer Kela L Masters, Senior Program Assistant Ericka M McGowan, Associate Program Officer Sybil A Paige, Administrative Associate Sandi ... critical for changes to take place Workshop Charge Ray then motivated the workshop participants to take advantage of this opportunity to reach across disciplines and learn from one another He...
  • 68
  • 375
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

Báo cáo khoa học

... decided to use the hierarchical clustering algorithm readily available in the MATLAB (MATrix LABoratory) programming language After some testing with various similarity functions and linkage types, ... in such a way that line crossings are avoided when connecting clusters As we can see, the dissimilarities among the top 30 associations to palm are all in the upper half of the scale and not ... hierarchical tree are related to the hand sense of palm, and all other words are related to its tree sense However, it is somewhat unsatisfactory that the word frond seems equally similar to both...
  • 4
  • 536
  • 0
SIMPLE OPEN ECONOMY MACRO WITH COMPREHENSIVE ACCOUNTING A RADICAL ALTERNATIVE TO THE MUNDELL FLEMING MODEL ppt

SIMPLE OPEN ECONOMY MACRO WITH COMPREHENSIVE ACCOUNTING A RADICAL ALTERNATIVE TO THE MUNDELL FLEMING MODEL ppt

Kế toán - Kiểm toán

... plays a key role, money has no accounting relationship to any other variable The model also contains no explicit analysis of what happens when either goods and services or financial assets are ... either country All parameters in these arrays are constrained according to Tobinesque principles so that the sum of constants is equal to one and the sum of each of the other columns is zero As ... exports, wealth and its allocation between the available assets and the exchange rate are all endogenously determined When the exchange rate changes, this changes the import propensity, disposable...
  • 13
  • 491
  • 0
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Kế toán - Kiểm toán

... financial year • records of statutory payments made, particularly on staff salaries • details of all assets The auditor may also ask to see: • a list of accruals – income the organisation has ... well as auditing the annual accounts, the auditor is usually available during the year to provide support and advice The audit is usually done as soon as possible after the close of the organisation’s ... Fundamentals of NGO Management of the organisation’s finances at a fixed point in time – usually at the end of its financial year All assets are added and all liabilities subtracted to compute the...
  • 76
  • 576
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học

... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... shows that, apart from OmcA and OmcB, the periplasmic fumarate reductase (FR), the cytoplasmic CymA and other, smaller (< 20 kDa), cytochromes are highly abundant c-type cytochromes in MR-1R, and...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

Báo cáo khoa học

... Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability to reduce the dimensionality of a ... clusters are much more salient Also, widely and rural are well within the adjective cluster The comparison of the two dendrograms indicates that the SVD was capable of making appropriate generalizations ... nouns and adjectives are not clearly separated, and the adjectives widely and rural are placed outside the adjective cluster With SVD, all 50 words are in their appropriate clusters and the three...
  • 4
  • 433
  • 0
A further contribution to the study of the mortuary customs of the North American Indians docx

A further contribution to the study of the mortuary customs of the North American Indians docx

Khoa học xã hội

... erected, to which the skulls and hair are attached as a trophy The bow, arrows, assagai, and clubs of the deceased are on the same post Large stones are pressed into the soil above and around the grave, ... in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a remarkable manner, precisely similar to that adopted ... tradition among the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, known as Karkhayahouchak Last year the captain was in the neighborhood of Kagamale...
  • 108
  • 604
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học

... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... checks to see if a morpheme sequence can correspond to the input stream by verifying that the appropriate phonological rules apply in the appropriate domains It then passes a 'flattened representation'...
  • 8
  • 522
  • 0
Small Business Survival: A Joint Report to the Governor pot

Small Business Survival: A Joint Report to the Governor pot

Quản trị kinh doanh

... Entrepreneurial Climate Rankings State Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland ... wholesale trade survive at higher rates than the average, while restaurant and accommodation, construction, and retail trade survival rates are lower than average Health care and wholesale trade have ... This is a national pattern as well, according to the literature Small firms are more critical to the rural economy than they are to the urban economy 61% SAN JUAN WAHKIAKUM COLUMBIA ISLAND PACIFIC...
  • 38
  • 278
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt

Báo cáo khoa học

... only As regards the second aim, the TCj which accompany a current word may reveal that it could be a possible indicator of a main clause, or subordinate clause, or a phrase If such is the case, an ... is associated with four designators: Its clause number (C), A Status Flag (v) to indicate whether the predicate of the clause has or has not occurred, Its phrase number (P), and A Backward Flag ... it, and (3) the most suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the...
  • 18
  • 701
  • 0
The road to reality   a complete guide to the laws of the universe    penrose, roger

The road to reality a complete guide to the laws of the universe penrose, roger

Vật lý

... would regard mathematical objectivity as really what mathematical Platonism is all about To say that some mathematical assertion has a Platonic existence is merely to say that it is true in an objective ... entities may relate to physical reality I recall that when at school, at the age of about 11, I was somewhat taken aback when the teacher asked the class what a fraction (such as 3) actually is! Various ... be the Sun It was a distant shaft of a deep Wery red light that beamed vertically upwards from the water into the heavens As he stood there, a dark cloud became apparent at the head of the beam,...
  • 1,123
  • 542
  • 4

Xem thêm