adaptive collaborative restoration a key concept in invasive plant management
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
Ngày tải lên :
19/02/2014, 02:20
... primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT ... fw, forward; rev, reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time ... using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢...
- 14
- 601
- 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx
Ngày tải lên :
23/03/2014, 20:22
... Kishida, Y., Kohora, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M & Tabata, S (2001) Complete genomic sequence of the filamentous ... value of this acid–base transition is estimated based on the increase of absorbance at 418 nm as pH increases Curve fitting of the fraction of the alkaline form to the calculated values using the Henderson–Hasselbalch ... examined The inset of Fig illustrates obtained titration plots It clearly indicates that the Syn HO-1 protein (10 lM) is saturated at a ratio of : hemin to protein, thereby establishing that...
- 12
- 459
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
Ngày tải lên :
31/03/2014, 01:20
... originally described as a CoA-independent acyltransferase inhibitor [16], was included as it inhibits both LPCAT and LPAAT in MonoMac cells with IC50 values of 10 lM and 30 lM, respectively (data ... level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There was a background level ... production in a similar manner, indicating that it may generally in uence monocyte in ammatory cytokine responses to LPS Our results suggest that acyltransferases play a key role in the production of in ammatory...
- 7
- 322
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
Ngày tải lên :
31/03/2014, 15:20
... increasing hydrogen ion concentration, involving a proton-catalysis by the distal (a5 8) histidine with pKa 6.2, as with the separated chains The value of ks also increased with increasing hydrogen ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against ... evidence suggests that the a1 b1 interface is much more important in maintaining normal hemoglobin stability than is the a1 b2 interface As a matter of fact, hemolytic anemia is known to result...
- 10
- 648
- 0
Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx
Ngày tải lên :
27/06/2014, 14:20
... does in building spaces only Today’s A/ C systems: • Maintain a healthy building environment o In commercial and new residential, A/ C provides ventilation air to maintain indoor air quality o A/ C ... will create some market risk Designing and installing a new DEVap system requires retraining DEVap has unknown longevity and reliability compared to standard A/ C The availability of natural gas or ... remaining refrigerants used today (R41 0A and R-13 4A) are strong contributors to global warming Their global warming potentials are 2000 and 1300, respectively (ASHRAE 2006) Finding data on air...
- 61
- 423
- 0
Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot
Ngày tải lên :
08/08/2014, 14:20
... experiments in the laboratory, in a pilot plant and in mills Many properties of wood and fibers are being measured at several levels of detail The arsenal of measurement techniques available today for ... definitely not lead to an increase in this proportion NATURAL VARIABILITY The natural variability has to be established as a basis for judging whether or not new trees are better than existing ... hemisphere A widespread species of this family is Populus tremula, also called aspen Aspen is also a very good raw material for printing papers and an increase in the production of aspen pulpwood...
- 12
- 229
- 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx
Ngày tải lên :
09/08/2014, 08:22
... 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ activated at 95°C for 10 minutes followed by 45 cycles of denaturing at ... according to a previously published and validated grading system where = no staining, = weak staining, = moderate staining, = strong staining, = very intense staining [6,13,17] Histopathology Pathological ... Animal work and handling were complied with the National Health and Research Council (Australia) Code of Practice for Animal Care in Research and Teaching (2004) [13] RNA extractions Total RNA was...
- 8
- 335
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
Ngày tải lên :
11/08/2014, 11:21
... and animals [5] and is involved in multiple signal transduction pathways, which are fundamental for many intercellular and intracellular interactions [6,7] Calcium plays an essential role in pollen-pistil ... Opin Plant Biol 1998, 1:428-433 34 Bednarska E, Lenartowska M, Niekraś L: Localization of pectins and Ca2+ ions in unpollinated and pollinated wet (Petunia hybrida Hort.) and dry (Haemanthus albiflos ... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using...
- 12
- 529
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
Ngày tải lên :
11/08/2014, 11:21
... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi ... 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism Plant Cell 2006,...
- 10
- 427
- 0
Báo cáo y học: "Lactate: a key metabolite in the intercellular metabolic interplay" pptx
Ngày tải lên :
12/08/2014, 18:21
... lactate was maintained at a higher but constant value, indicating that the liver is not mandatory for lactate clearance [20] Lactate also appears to possess some specific effects besides its role in ... new and fascinating side of brain lactate metabolism [24,25] Concerning heart metabolism and cardiovascular function, it has recently been shown that lactate improves cardiac function in a model ... time also as a gluconeogenic organ, has probably been underestimated [1] Moreover, it was recently shown that even during the anhepatic phase occurring during liver transplantation, plasma lactate...
- 3
- 251
- 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps
Ngày tải lên :
12/08/2014, 20:20
... regarding the use of steroids in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration ... therapy Steroid therapy causes significant adverse effects, and this remains true in patients with SARS Wang and coworkers [12] described a case of fatal aspergillosis, and recent press reports indicate ... Lapinsky Systemic steroids have been used in the treatment of SARS based on the hypothesis that disease manifestations are in part due to the host’s inflammatory response Many questions regarding...
- 3
- 355
- 0
Báo cáo y học: " The HBZ gene, a key player in HTLV-1 pathogenesis" doc
Ngày tải lên :
12/08/2014, 23:21
... 3:15 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, et al.: A novel alternative splicing isoform of human T-cell leukemia virus ... USA 1981, 78:6476-6480 Takeda S, Maeda M, Morikawa S, Taniguchi Y, Yasunaga J, Nosaka K, Tanaka Y, Matsuoka M: Genetic and epigenetic inactivation of tax gene in adult T-cell leukemia cells Int ... Koiwa T, Hamano-Usami A, Ishida T, Okayama A, Yamaguchi K, Kamihira S, Watanabe T: 5'-long terminal repeat-selective CpG methylation of latent human T-cell leukemia virus type provirus in vitro and...
- 8
- 585
- 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx
Ngày tải lên :
12/08/2014, 23:21
... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, ... out-of-hospital cardiac arrest JAMA 2005, 293:299-304 Abella BS, Alvarado JP, Myklebust H, Edelson DP, Barry A, O'Hearn N, Vanden Hoek TL, Becker LB: Quality of cardiopulmonary resuscitation after in- hospital ... of the greatest advances in critical care medicine during the past decade Similarly, recent technology has also enhanced the quality of basic CPR For the past four decades, basic CPR has been performed...
- 3
- 280
- 0
use - a useful concept in trade mark law – comparing vietnamese, eu and us law
Ngày tải lên :
18/08/2014, 12:36
... "secondary meaning," a mark that was descriptive in its primary meaning can be shown to have acquired a secondary meaning as a trademark associated only with a particular product Such proof ranges ... trade mark law regulates many issues relating to what sign can be a trade mark, what sign cannot be a trade mark, and what sign can become a trademark through use The elements allowing trade mark ... of Trade Mark under International and 2.1 National Law∗ 2.1.1 International Law Owing to the importance of trade marks, there are many international agreements in the trade mark field They include...
- 68
- 205
- 0
Educational Triangular Pyramid A New Concept in Education
Ngày tải lên :
13/08/2015, 10:21
... simply, a triangular pyramid is a tetrahedron having a top and a bottom which is a triangle Its three side faces are triangles We can think that this may be a full illustration of the relationship ... human being As Anatole France once said: "Nine tenths of education is encouragement" And in the same vein, William A Ward maintained: “The mediocre teacher tells The good teacher explains The superior ... that has obsessed me About five years ago, when I was flying from Tan Son Nhat Airport (Ho Chi Minh City) to Hanoi, I saw a foreigner walking to the stairs for boarding He was pulling a suitcase...
- 6
- 212
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... Boehringer (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, ... enthalpy change (DHcal) of each protein was calculated by integration of the curve covering area (Tm was taken as the curve peak point) using origin software Acknowledgements This work is partially...
- 7
- 551
- 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
Ngày tải lên :
07/03/2014, 21:20
... (5¢-GCAAATGCAACTGGA AGCGG-3¢) and A1 (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢) and A2 (5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification ... brasiliensis in protein databases, showing high homology to cis-prenyltransferase, such as AAM92880 (AAM92889, AAM92890), AAM92881, AAM92879, BAB92023 (AAM92883, AAM92884, AAM92885, AAM92887, AAM92888), ... template and then sequenced Finally, two cDNAs were obtained and designated HRT1 and HRT2, respectively DNA sequencing analysis Materials and methods Plant materials and RNA isolation Latex and various...
- 10
- 516
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
Ngày tải lên :
30/03/2014, 04:20
... Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int J Radiat ... during intermittent hypoxia ⁄ reoxygenation Biochem Biophys Res Commun 355, 728–733 Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that ... extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and continuous activation of...
- 12
- 390
- 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
Ngày tải lên :
30/03/2014, 20:20
... somata (S) of the brain Fluorescence images were converted to grayscale and inverted into black and white images An area adjacent to the area of interest (A) and an area from an image lacking a ... to as the MEF2 domain The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an important role in DNA binding affinity as well as an indirect role in dimerization ... axon emanating from the somata (light blue arrowheads and enlarged image shown in E) runs towards the midline of the brain with some arborization (boxed area in A) , contralateral after crossing...
- 10
- 437
- 0