adaptable dialogue architecture and runtime engine a new architecture for health care dialogue systems
Báo cáo khoa học: "Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig Heart" ppt
... Avantec Inc., A: An’s Cannula B: Casali’s cannula Fig The new coronary cannula maded for this study (A: An’s Cannula) and the coronary cannula used in the work of Casali et al (B: Casali’s cannula) ... area of aorta cardioplegia cannula placed into aorta Inferior Vena Cava(VCI) and pulmonary vein(PV) localized 10 VCI clamped 11 aorta clamped and 4℃ cardioplegia infused at 300 mmHg simultaneously ... 20mA In the control isolated hearts, the attachment of aorta and pulmonary artery is separated Two coronary arteries were isolated and placed a stay suture material 3-0 silk (Ethicon, U.S .A) ...
- 14
- 431
- 0
Hyperscsi design and development of a new protocol for storage networking
... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... parameter to determine the total data transfer rate and packet loss ratio RBUDP separates the signaling control and data communication channel to achieve higher data transfer rate The analytical ... distance network scenario There are also other similar candidates, such as FOBS [81] and Tsunami [82] These approaches all share the same properties, namely: Separate the data and control channel...
- 169
- 515
- 0
Tài liệu Health education: A practical guide for health care projects docx
... resources available) Using theatre can also be beneficial, as shown by a study carried out in 2001 in a rural area in India The Kalajatha theatre was used there as a means of IEC on Malaria Local artists ... for all human beings, and on the other hand, a constantly questioned adaptation of humans to an environment in perpetual transformation (Ottawa Charter); – “The mental and physical state relatively ... programme for bio-environmental control of malaria through folk theatre (Kalajatha) in rural India Malaria Journal 2006, 5: 123 EN 1A page 08 1B page 09 a closer look at health concepts what is health...
- 53
- 563
- 1
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the...
- 11
- 715
- 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt
... clupeotoxism) and respiratory intoxications Palytoxin enters the food chain and accumulates mainly in fishes such as sardines, 6068 herrings and anchovies from tropical seas, causing neurological and gastrointestinal ... S, Inoue A, Kan Y & Yasumoto T (1995) Palytoxin analogs from the dinoflagellate Ostreopsis siamensis J Am Chem Soc 117, 5389–5390 Taniyama S, Arakawa O, Terada M, Nishio S, Takatani T, Mahmud Y ... ions, Na+ ⁄ K+-ATPase also acts as a signal transducer [44,45] In this respect, studies carried out with ouabain, a natural blocker of the Na+ pump and an inhibitor of palytoxin action, have provided...
- 8
- 691
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... and MP analyses In this clade, RpCAbr is most closely related to the previously sequenced RpCAtr (BPNJ ¼ 100 and BPMP ¼ 99) Fungia scutaria (FCA -a and FCA-b) and Caenorhabditis elegans (CA1 and ... and RpCAtr by quantitative PCR RpCAbrFqa TGG RpCAbrRqa GGT RpCAtrFqa GCC RpCAtrRqa TCA Full-length sequencing of RpCAbr RpCAbrF TAC RpCAbrR1 CGT RpCAbrR2 AGA RpCAbrR3 GTT Probe amplification for...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
- 11
- 873
- 0
A New Vision for Adolescent Sexual and Reproductive Health pot
... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... methods than are their American peers As noted, they are less likely to be poor and they have greater access to sexual and reproductive health care services Dutch policy makers and health care providers, ... European levels without fundamental changes in adult social in adult social norms norms regarding access to health information and to reproductive regarding access to health services health information...
- 7
- 662
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, which is not a substrate ... standard error, n ¼ Lys[Z(NO2)]-Val, Lys(4-nitrobenzyloxycarbonyl)-Val Compound Bip-[3H]Pro uptake (%) Control Gly Gly-Sar Bip-Pro Ala-Ala Pro-Ala Lys-Lys Ala-Asp D-Phe-Ala Ala-Ala-Ala d-Aminolevulinic ... [Gly1-14C]Gly-Sar (specific radioactivity 53 mCiÆ mmol)1) was custom synthesized by Amersham International (Little Chalfont, UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic...
- 10
- 490
- 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates for the rapid and sensitive ... 2007 The Authors Journal compilation ª 2007 FEBS N Zaidi et al Parallel detection of CatE and CatD activity TAPA and specific catalytic activities of CatE and CatD were determined fluorimetrically...
- 12
- 645
- 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
... molecular mass markers are indicated in kDa F 4¢-OMT activity towards the different assayed substrates, transformation products and kinetic analysis The enzyme became inactive when the assayed substrates ... the assayed compound and its respective transformation product was determined by comparison of peak data with those obtained from authentic standards chromatographed at different known concentrations ... hydroxybenzoic acid (I, II) and hydroxycinnamic acid (III, IV) derivatives assayed as substrates for the flavonoid 4¢-OMT The carnation cultivar ÔNovadaÕ was obtained from the DLO Institute, Wageningen,...
- 10
- 624
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... N-D-AAase, was also produced in the Escherichia coli, purified and characterized MATERIALS AND METHODS Bacterial strains, plasmids and conditions Variovorax paradoxus Iso1 was isolated from an ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, a new beta-lactam compound II Separation and purification of L-amino acid acylase...
- 11
- 656
- 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx
... GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen Biotechnology Co., Ltd, Shanghai, China) (Otsu, Japan) The ... L-aspartate was adjusted to 100 b 30 mM L-aspartate was used as amino donor for a- ketoglutarate, and 30 mM L-glutamate was used as amino donor for oxaloacetate The activity of a- ketoglutarate was ... necessary to form lmolÆmin)1 of oxaloacetate The aromatic amino acid aminotransferases were assayed according to Mavrides and Orr [37] The assay was established for AAT except that aspartate was...
- 13
- 490
- 0
Stroke and the Family a new guide pdf
... information rather than a guide to specific care Several broad classes of treatment are currently available and will be discussed as categories antiplatelet medications Platelets are small particles that ... medications are given as injections once or twice daily, and are at least as effective as heparin, safer, and easier to administer and monitor They are generally used for short-term treatment for ... medications can cause or contribute to a cerebral hemorrhage Coumadin (warfarin) can cause cerebral hemorrhage, most typically if the dosage is too high for a particular individual and the anticoagulant...
- 283
- 412
- 0
Food and health in Europe: a new basis for action pdf
... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... information and data so that they can make informed decisions to prevent harm Nationally collected data can be compared with international norms and standards to ensure that public health is at...
- 38
- 334
- 0
Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt
... dedicated funding streams and annual appropriations NASA (an IGA) receives annual appropriations In the case of annual appropriations, the Senate and House will be required to authorize and appropriate ... standards for research quality and objectivity Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials Lynn E Davis, Debra Knopman, ... M&O management and operations MDO management and disposition organization MDWG Management and Disposition Working Group MRS monitored retrievable storage NASA National Aeronautics and Space Administration...
- 132
- 357
- 0
Food and health in Europe: a new basis for action pptx
... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... tropical-plant fat and oil, are also strong stimulators for raising LDL levels, as are some transfatty acids (49) A major saturated fat, stearic acid, present in beef fat and lard, a 300 Men 200 100 Deaths...
- 405
- 635
- 0
RBF Neurals Networks and a new algorithm for training RBF networks
... D.S Bromhead and D Lowe, “Multivariable functional interpolation and adaptive networks”, Complex Systems, vol 2, 1988, pp 321-355 J.Park and I.W Sandberg “Approximation and radial-basis-function ... Intelligent Learning Systems and Applications, Vol.3 No.1, February 2011, pp 17-25 20 Tomohiro Ando, Sadanori Konishi and Seiya Imoto, Nonlinear regression modeling via regularized radial basis function ... Approx (1986), pp 11–22 17 M H Mousoun, Fundamental of Artificial Neural Networks, MIT Press, Cambridge, MA, 1995 22 G E Fasshauer and Jack G Zhang, “On Choosing “Optimal” Shape Parameters for...
- 22
- 270
- 0
Control and implementation of a new modular matrix converter
... −Vcap −Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap −2Vcap 2Vcap 2Vcap −2Vcap −2Vcap 2Vcap −2Vcap −2Vcap −2Vcap 2Vcap −2Vcap ... Phase C -Vcap+ Phase A vCA Phase a Vab = Vcap VAB = -Vcap VCA = Vcap Phase B Phase b VBC = 0V Vbc = 0V Vca = -Vcap -Vcap+ Phase A Phase a Vab = Vcap VAB = -Vcap VCA = Vcap Phase B Vca = 0V Phase ... Phase A Phase a ap+ -Vc VAB = V Vab = Vcap Phase B Phase b Phase c Phase C -Vcap+ Phase A Phase a VAB = -Vcap VCA = Vcap Phase B Vab = Vcap +Vcap+V VBC = 0V +V Phase C +Vcap-Vcap+ Phase A + Phase...
- 7
- 334
- 1
uninhibited robust and wide-open a free press for a new century jan 2010
... providing that, if a candidate for [political office] is assailed regarding his personal character or official record by any newspaper, the candidate has the right to demand that the newspaper print, ... With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine Vietnam Copyright ... several decades, as state courts and legislatures pursued legal variations on a theme of civil damages for publication of private and embarrassing facts, unless the information was deemed “newsworthy.”...
- 225
- 575
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25