activity to show angle sum property of a triangle
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
Ngày tải lên :
19/02/2014, 18:20
... M. pneumoniae,
although a SPase I activity has been shown to be
essential for cell viability in all bacteria analyzed [26].
To test experimentally whether there is a type I
SPase activity in ... [23–25]. Such signal peptides are normally
cleaved off by a bacterial type I signal peptidase
(SPase). The various type I SPases from Gram-negat-
ive and Gram-positive bacteria show clear differences
concerning ... if at all, affected by these
two reactions. Two amino acid modifications were
detected: tryptophan 248 was oxidized to a minor
extent and asparagine 205 was, to some extent, con-
verted to aspartic...
- 9
- 559
- 1
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
Ngày tải lên :
07/03/2014, 00:20
... hydantoinase, allantoinase
and dihydrooratase [32]. Cyclic amidohydrolases share
a number of physicochemical characteristics. These
characteristics include quaternary, tertiary, secondary
and ... 0
Loktanella vestfoldensis SKA53 Proteobacteria, Alphaproteobacteria 2 0
Roseovarius sp. HTCC2601 Proteobacteria, Alphaproteobacteria 2 0
Ralstonia eutropha H16 Proteobacteria, Betaproteobacteria ... decarboxyl-
ation of OHCU to (S)-allantoin. Thus, the pathway of
the conversion of uric acid to (S)-allantoin via the three
enzymes uricase, TLP (5-HIUase) and OHCU decar-
boxylase was revealed...
- 13
- 390
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... Hierarchy in a modified hidden
Markov model
Lin-Yi Chou
University of Waikato
Hamilton
New Zealand
lc55@cs.waikato.ac.nz
Abstract
This paper explores techniques to take ad-
vantage of the fundamental difference ... second
dataset is part of the Lancaster Treebank corpus
and contains 1473 sentences. Each sentence con-
tains hand-labeled syntactic roles for natural lan-
guage text.
A. 200
A. 400
A. 600
A. 800
A. 1000
A. 1200
A. 1400
0.86
0.88
0.90
0.92
0.94
B.200
B.400
B.600
B.800
B.1000
B.1200
B.1400
0.86
0.88
0.90
0.92
0.94
0.86
0.88
0.90
0.92
0.94
F
C.200
C.400
C.600
C.800
C.1000
C.1200
C.1400
0.86
0.88
0.90
0.92
0.94
0.86
0.88
0.90
0.92
0.94
F
Figure ... flattened hierarchical hid-
den Markov model (PFHHMM) can assign propo-
sitions to language texts (grammar parsing) at least
as accurately as the HMM. This is assignment is a
task that HHMMs are...
- 8
- 528
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
Ngày tải lên :
16/03/2014, 05:20
... RNAi
To prepare a DNA template for the synthesis of dsRNA,
DNA corresponding to the mature peptide of MeMIH-B
was amplied by PCR using T7 promoter-linked primers
(forward, 5Â-TAATACGACTCACTATAGGTACTATG
TATCGCATGCCAAT-3Â; ... primers
(forward, 5Â-TAATACGACTCACTATAGGTACTATG
TATCGCATGCCAAT-3Â; reverse, 5Â-TAATACGACTC
ACTATAGGTACTTTAAAGTCCCGGGTTGA-3Â). For
PCR, the reaction mix consisted of 1 Ã Taq buffer contain-
ing 1.5 mm MgCl
2
, ... Morera Y, Rodriguez T, Huberman A,
Ramos L & Estrada MP (2006) Molecular cloning and
characterization of the crustacean hyperglycemic hor-
mone cDNA from Litopenaeus schmitti. Functional
analysis...
- 11
- 546
- 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx
Ngày tải lên :
23/03/2014, 05:22
...
summarized the average and maximum testing
capacity in appendix 2. The ratio of the maximum
capacity to the average capacity available is about
2.5. Again, this indicates that the average capacity ... large lab). The size of the small labs
might be related to comparative advantage. E.g.
the price advantages of the small labs might be due
to advantages of specialization. Small labs generally ... incorporates all the relevant data. However,
there is no general standard for an acceptable level
of price variability. Thus, we had to fix a
reasonable boundary.
The ratio mean to median of a sample...
- 19
- 493
- 1
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot
Ngày tải lên :
23/03/2014, 09:21
... model of amyloid protofilament formation
may also be relevant for the CSP and may explain
why a bipartite organization can be observed in the
late stage of Ec-CspA amyloidogenesis [28]. To form
extended ... can now define a com-
mon interaction interface that allows us to understand
A
B
Fig. 4. Binding of hexathymidine to amphipathic platforms of a Bc-
Csp swapped dimer. (A) Topological representation ... Mutational analysis of the puta-
tive nucleic acid-binding surface of the cold-shock
domain, CspB, revealed an essential role of aromatic
and basic residues in binding of single-stranded DNA
containing...
- 15
- 333
- 0
Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a flexible generation architecture" pot
Ngày tải lên :
31/03/2014, 04:20
... Generation, commonly viewed as a single
task, needs to have access to at least rhetorical and
document information as well as referencing and
adding to the syntactic information.
To accommodate ... Rosner, and O. Stock, editors, Aspects of Au-
tomated Natural Language Generation, number LNAI-
587. Springer-Verlag.
B. Lavoie and O. Rambow. 1997. A fast and portable re-
alizer for text generation ... communicate exclu-
sively via the OASYS server.
The O /A data representation is a simple
typed network representation language. An O /A
database consists of a collection of objects, each
of which has a...
- 8
- 368
- 0
peer-to-peer harnessing the benefits of a disruptive technology
Ngày tải lên :
01/06/2014, 10:58
...
What do we mean by metadata? In the case of Napster, metadata means the combination of artist and
song names that users search for. It also includes additional data managed by the central Napster ... DNS are directly applicable to
contemporary peer -to- peer data sharing applications.
DNS was established as a solution to a file-sharing problem. In the early days of the Internet, the way
to ... application that is
transmitting bulk data; it would be a significant advance to make sure that a program does not have to
retransmit or resend data to another host. Caching is a well understood technology:...
- 265
- 535
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
Ngày tải lên :
18/06/2014, 22:20
... used. To
monitor the presence of TULV S RNA on passages, RT-PCR
was performed with primers VF738
(5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and
VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H,
Vaheri A, Plyusnin A: Isolation and characterization of Tula
virus: a distinct serotype in genus Hantavirus, family Bunya-
viridae. J Gen Virol ... presence of the
Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULVFigure 2
Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
Ngày tải lên :
20/06/2014, 04:20
... passages, RT-PCR
was performed with primers VF738
(5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and
VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt
831–855). To monitor the presence of ... presence of recS-RNA on the passages was mon-
itored by RT-PCR and the isolate appeared to have a stable
genotype (data not shown). RecTULV formed foci similar
in size to those of the original variant ... Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H,
Vaheri A, Plyusnin A: Isolation and characterization of Tula
virus: a distinct serotype in genus Hantavirus, family Bunya-
viridae. J Gen Virol...
- 5
- 430
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
Ngày tải lên :
18/06/2014, 16:20
... developed a human blood biomarker assay that
detects the blocking activity of Ab-01, an antibody to
IL21R. In parallel we have developed an adaptation of this
assay and used it to demonstrate that the ... housed and cared for according to the
American Association for Accreditation of Laboratory
Animal Care guidelines. The Wyeth Institutional Animal
Arai et al. Journal of Translational Medicine 2010, ... 8:647-653.
6. Ray CA, Dumaual C, Willey M, Fill J, O'Brien PJ, Gourley I, Devanarayan V,
Konrad RJ: Optimization of analytical and pre-analytical variables
associated with an ex vivo cytokine...
- 13
- 528
- 0
