0

activity 1 match the verbs in a with one suitable expression in b

Tài liệu TNXH 1 - BÀI 1: CƠ THỂ CHÚNG TA A. Mục tiêu: -Kiến thức : Kể tên các bộ phận chính của docx

Tài liệu TNXH 1 - BÀI 1: CƠ THỂ CHÚNG TA A. Mục tiêu: -Kiến thức : Kể tên các bộ phận chính của docx

Mầm non - Tiểu học

... em thi đua nói Hoạt động 2:Quan sát tranh *Mục tiêu:Nhận biết hoạt động -Từng cặp quan sát thảo luận phận b n thể gồm ba phần chính:đầu, mình,tay chân *Cách tiến hành: B ớc 1:< /b> Làm việc theo nhóm ... dẫn học sinh:Hãy nói tên -Đại diện nhóm lên b ng v a < /b> phận b n thể? -GV theo dõi giúp đỡ HS trả lời v a < /b> nêu tên phận b n thể B ớc 2:Hoạt động lớp -Gvtreo tranh gọi HS xung phong lên b ng -Động ... 3 .B i mới: Hoạt động GV Hoạt động HS Giới thiệu : Ghi đề Hoạt động 1:< /b> Quan sát tranh *Mục tiêu:Gọi tên phận b n thể *Cách tiến hành: -HS làm việc theo hướng dẫn GV B ớc 1:< /b> HS hoạt động theo...
  • 5
  • 978
  • 0
Grief Dreams How They Help Heal Us After the Death of a Loved One pdf

Grief Dreams How They Help Heal Us After the Death of a Loved One pdf

Thời trang - Làm đẹp

... and David “About four months after my fiancé, David, died,” says Katherine, “I began having dreams about him.” Katherine recalls one < /b> particular dream a < /b> visitation dream—that brought her a < /b> great ... in < /b> our dreams Jung found that dreams often contained universal archetypal images By understanding the < /b> archetypal image in < /b> a < /b> particular dream, he was better able to understand the < /b> dream An example ... stories are told in < /b> this book have been changed Library of Congress Cataloging -in-< /b> Publication Data Wray, T J Grief dreams : how they help heal us after the < /b> death of a < /b> loved one < /b> / [by T J Wray and Ann...
  • 225
  • 377
  • 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

Báo cáo khoa học

... under the < /b> accession numbers AF1 912< /b> 78, AF1 912< /b> 79 (for CYP1 1B1 ), AF1 912< /b> 81,< /b> AF1 912< /b> 80 (for CYP1 1B2 ), and AF1 912< /b> 82 (for CYP1 1B3 ) RESULTS In < /b> a < /b> previous study we isolated an 11< /b> b- hydroxylase of the < /b> guinea ... 5, the < /b> omission of Adx leads to a < /b> sharp decrease in < /b> the < /b> activity < /b> for the < /b> 11< /b> b- hydroxylase, CYP1 1B1 Intriguingly, however, the < /b> 11< /b> b- hydroxylase activity < /b> of the < /b> aldosterone synthase CYP1 1B2 was basically ... amounts of 11< /b> b( OH)-androstendione were synthesized by CYP1 1B2 in < /b> comparison with < /b> CYP1 1B1 (Fig 4C) It is noteworthy, that CYP1 1B2 displayed a < /b> higher enzymatic activity < /b> than CYP1 1B1 based on 11< /b> b- hydroxylase...
  • 9
  • 671
  • 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học

... kDa form ( 71 < /b> kDa in < /b> the < /b> recombinant insectproduced form) The < /b> appearance of an intermediate molecular form can also be seen as a < /b> 74 kDa protein Both C-terminal cleavages were proposed to be accomplished ... phase (acetonitrile containing 0 .1%< /b> trifluoroacetic acid) followed by a < /b> 1%< /b> Æmin )1 < /b> linear gradient of organic phase to 65% with < /b> a < /b> flow rate of mLÆmin )1 < /b> Elution was monitored by measuring the < /b> absorbance ... was cloned into a < /b> pet2 4b+ bacterial expression < /b> vector The < /b> resulting C-terminally His-tagged protein was expressed in < /b> Escherichia coli strain BL 21 < /b> (DE3) (Novagen, Mississauga, Canada) after induction...
  • 10
  • 305
  • 0
báo cáo hóa học:

báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx

Hóa học - Dầu khí

... to activate caspase-8 [11< /b> -13< /b> ] TRAIL may also interact with < /b> two decoy receptors (TRAIL-R3 and -R4) that are unable to transduce death signals [14< /b> ,15< /b> ] Upon TRAIL binding, activated TRAIL-R1 and ... followed by platinum-based chemotherapy Clinical data were obtained from the < /b> medical record The < /b> disease-free interval was defined as the < /b> interval between the < /b> surgery and the < /b> date of progression of the < /b> ... Lane et al.: The < /b> prosurvival activity < /b> of ascites against TRAIL is associated with < /b> a < /b> shorter disease-free interval in < /b> patients with < /b> ovarian cancer Journal of Ovarian Research 2 010< /b> 3 :1 < /b> Publish with...
  • 10
  • 383
  • 0
Báo cáo y học:

Báo cáo y học: " Liposarcoma of the forearm in a man with type 1 neurofibromatosis: a case report" ppsx

Báo cáo khoa học

... interpreted the < /b> patient data regarding the < /b> NF1 and liposarcoma MDS carried out the < /b> operation on the < /b> patient and was the < /b> main contributor in < /b> the < /b> writing of the < /b> manuscript All authors read and approved the < /b> ... present a < /b> case of forearm liposarcoma in < /b> a < /b> patient with < /b> NF1 Case presentation A < /b> 41-< /b> year-old Caucasian man, known to have generalized NF1 since the < /b> age of 21,< /b> presented at our clinic complaining of a < /b> ... review by Dalal et al is in < /b> agreement and suggests that chemotherapy for soft-tissue sarcoma should be regarded as suitable < /b> for initial investigation or clinical trials and is rarely indicated,...
  • 5
  • 266
  • 0
Báo cáo y học:

Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx

Báo cáo khoa học

... 81:< /b> 6623-66 31 < /b> 51 < /b> Jiang M, Mak J, Wainberg MA, Parniak MA, Cohen E, Kleiman L: Variable tRNA content in < /b> HIV-1IIIB Biochem Biophys Res Commun 19< /b> 92, 18< /b> 5 :10< /b> 05 -10< /b> 15 52 Onafuwa-Nuga AA, Telesnitsky A,< /b> ... possibility that the < /b> mutations have changed the < /b> subcellular localization or trafficking of Gag, resulting in < /b> a < /b> change in < /b> RNA binding preference Page of 12< /b> measure the < /b> packaging efficiency of Y1, ... that both variants still harbored the < /b> SL1 deletion found in < /b> NLΔSL1 (data not shown) A < /b> G 913< /b> A < /b> substitution (NL4-3 numbering) was found in < /b> the < /b> matrix (MA) of NLΔSL1-D22, leading to an E42K amino acid...
  • 12
  • 300
  • 0
Báo cáo y học:

Báo cáo y học: "Over-expression of glutamine synthase in focal nodular hyperplasia (part 1): Early stages in the formation support the hypothesis of a focal hyper-arterialisation with venous (portal and hepatic) and biliary damage" pps

Báo cáo khoa học

... using α-SMA staining The < /b> blue arrow indicates an artery, whereas the < /b> black arrow indicates a < /b> small hepatic vein (insert) with < /b> a < /b> thick wall and a < /b> narrow almost absent lumen Page 12< /b> of 28 (page ... veins A < /b> – GS staining B – α-SMA staining In < /b> the < /b> rather faint GS-positive area, a < /b> small hepatic vein (black arrow) was identified on the < /b> right The < /b> vascular lumen was no longer observed on the < /b> left ... micrograph (B) shows H&E staining The < /b> GS stained area is wider in < /b> the < /b> nodular part than in < /b> the < /b> nonnodular part The < /b> lobular structure of the < /b> liver is not easily visible in < /b> the < /b> nodular part Page of...
  • 28
  • 230
  • 0
the essence of a university and scholarly activity in accounting, with reference to a department of accounting at a south african university

the essence of a university and scholarly activity in accounting, with reference to a department of accounting at a south african university

Kế toán - Kiểm toán

... (SAICA 200 7b) whose undergraduate and graduate programmes are accredited by SAICA and whose syllabi are by implication also accredited by SAICA (200 7a)< /b> As far as could be ascertained, the < /b> research ... design and the < /b> choice of methodology and greater clarification of the < /b> formulation of the < /b> research problem can be obtained from Babbie and Mouton’s (20 01:< /b> 15) diagram below (the < /b> diagram has been adapted ... in < /b> the < /b> Department of Accounting It can therefore be assumed that the < /b> academic training of accountants in < /b> general, and later prospective chartered accountants in < /b> particular, was the < /b> main academic...
  • 26
  • 380
  • 0
Báo cáo y học:

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Y học thưởng thức

... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial ... end-point was definite stent thrombosis (acute, day; subacute, to 30 days; late, >30 days and very late, >1 < /b> year) Myocardial infarction was defined as a < /b> creatine kinase (CK) elevation >2 times above ... procedure, a < /b> bolus dose of unfractionated heparin (10< /b> 0 U/kg) was injected through the < /b> femoral or radial artery sheath, with < /b> repeated boli administered as needed to maintain activated and clotting time...
  • 6
  • 550
  • 0
two-word phrasal verbs with the particle in that require into when used with an object

two-word phrasal verbs with the particle in that require into when used with an object

Ngữ pháp tiếng Anh

... Infinitive present tense break in < /b> -ing form past tense past participle break in < /b> & breaks in < /b> breaking in < /b> broke in < /b> broken in < /b> break inlinto p.v When you break in < /b> or break into a < /b> place, you ... broken them in < /b> yet We're breaking in < /b> a < /b> new secretary, so things have been a < /b> bit confused at our office lately broken in < /b> part.adj After you break in < /b> a < /b> new mechanical device or a < /b> car, a < /b> pair of ... then I became up — I changed from not being up to being up.) Many phrasal verbs < /b> with < /b> get that relate to a < /b> change in < /b> physical location might seem identical in < /b> meaning to a < /b> variety of phrasal verbs...
  • 17
  • 633
  • 0
A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

Khoa học xã hội

... 4 34 Rate 14< /b> .7% 11< /b> .8% 14< /b> .7% 11< /b> .8% 11< /b> .8% 8.7% 11< /b> .8% 14< /b> .7% 10< /b> 0% 25 26 Table 4.53 A < /b> Summary of the < /b> Meaning Nuances of SVs Private Meaning Common Meaning Nuances Nuances Group of Meaning Verbs < /b> Occurrence ... are analyzed basing on the < /b> theoretical background by Quirk et.al [33] such as the < /b> construction of the < /b> verbs,< /b> verb phrases The < /b> semantic characteristics are shown like the < /b> meaning nuances and the < /b> ... followed by a < /b> that- clause either with < /b> putative “should” or with < /b> the < /b> subjunctive mood and the < /b> third possibility, a < /b> that- clause with < /b> an 13< /b> 14< /b> indicative verb In < /b> addition, it combines with < /b> the < /b> infinitive...
  • 13
  • 1,330
  • 5
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

Báo cáo khoa học

... spectra, and by 1H ,13< /b> C-HMBC correlations The < /b> typical lipid A < /b> carbohydrate backbone was eventually assigned on the < /b> basis of the < /b> NOE signal between H -1 < /b> G and H- 6a,< /b> b B In < /b> the < /b> case of Kdo units, which lack ... and characterized [12< /b> ,13< /b> ], mainly from Pseudomonas aeruginosa strains [ 21,< /b> 37–43] The < /b> carbohydrate backbone of the < /b> so-called inner core region of Pseudomonas LPS determined so far has always been ... polysaccharide from lipopolysaccharide of Acinetobacter calcoaceticus strain (DNA group 1)< /b> Eur J Biochem 243, 16< /b> 7 17< /b> 3 47 Nikaido, H & Vaara, M (19< /b> 85) Molecular basis of bacterial outer membrane...
  • 14
  • 715
  • 0
Đề tài

Đề tài " The distribution of integers with a divisor in a given interval " ppt

Thạc sĩ - Cao học

... P + (a1< /b> )≤eσ a1< /b> >t1/8 log a1< /b> a1< /b> log2 P + (a1< /b> ) a < /b> ∈P(eσ ,teσ ) L (a2< /b> ; σ) a2< /b> By Lemma 2.5, the < /b> sum on a1< /b> in < /b> (7.5) is ≤4 j∈Z:t2−j ≤e2σ 22j log2 t −j 1 < /b> t2 a1< /b> >t1/8 −j )≤t2 log a1< /b> a1< /b> j−5 ... L (a;< /b> σ) ≤ τ (a1< /b> )L (a2< /b> ; σ) ≤ στ (a1< /b> )τ (a2< /b> ) (7.6) Also (7.7) a1< /b> τ (a1< /b> ) a1< /b> >w −3/4 a1< /b> w 1/< /b> 4 (w ≥ 1)< /b> a1< /b> >w ˆ The < /b> contribution to S(t; σ) coming from those a < /b> with < /b> a1< /b> ≥ t1/8 is thus (7.8) σ a2< /b> ... 1+< /b> log a1< /b> η L (a2< /b> ; η) r,C log a1< /b> L (a2< /b> ; η) η 412< /b> KEVIN FORD Also, t15 /16< /b> /h + P + (h) ≥ P + (a1< /b> ) ≥ eθ , so T5 r,C η3 a1< /b> ∈P(eθ ,eη ) a1< /b> >t1 /16< /b> log a1< /b> a1< /b> a2< /b> ∈P(eη ,teη ) L (a2< /b> ; η) a2< /b> By Lemma...
  • 68
  • 409
  • 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... VPS 4B contains the < /b> b domain (b strands and 8), the < /b> final helix of the < /b> AAA domain (a < /b> helix 10< /b> ) and the < /b> C-terminal helix (a < /b> helix 11< /b> ) This C-terminal region of Vps4 has been defined in < /b> the < /b> PFAM database ... the < /b> AAA domain helix and the < /b> C-terminal helix) However, the < /b> majority of these proteins are likely to be other meiotic clade AAA ATPases and have the < /b> AAA domain helix and the < /b> C-terminal helix, but...
  • 23
  • 490
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học

... for the < /b> M100K variant, with < /b> an r.m.s.d for the < /b> ˚ backbone atoms of 0.4 A < /b> Significant deviations for main- and side-chain atoms in < /b> the < /b> ligand loop containing the < /b> K100 are however, observed To accommodate ... results in < /b> deprotonated protein based ligands such as Lys, His and if available the < /b> N-terminal a-< /b> amino group competing for the < /b> vacant coordination site [11< /b> , 31,< /b> 38–40] Owing to the < /b> paramagnetic ... accommodate K100 as a < /b> ligand a < /b> number of main-chain atoms are displaced relative to their positions in < /b> the < /b> wt structure Although backbone deviations are detected at the < /b> start of the < /b> ligand loop, the...
  • 15
  • 509
  • 0
Internal audit in banks and the supervisor’s relationship with auditors: A survey pdf

Internal audit in banks and the supervisor’s relationship with auditors: A survey pdf

Kế toán - Kiểm toán

... Settlements at www.bis.org This document is also known as International Auditing Practice Statement 10< /b> 04 The < /b> IAPC has been renamed International Auditing and Assurance Standard Board (IAASB) The < /b> Survey ... Austria and Singapore, observers in < /b> the < /b> Committee’s Accounting Task Force, also participated in < /b> the < /b> survey The < /b> information about banks that was gathered in < /b> the < /b> survey is based on the < /b> national supervisory ... regulation or by both An audit charter enhances the < /b> standing and authority of the < /b> internal audit department within the < /b> bank 27 All audit charters are approved by the < /b> board of directors or at an...
  • 16
  • 522
  • 0

Xem thêm