activin tgf 1 and nodal secreted by the primitive endoderm guide epiblast cells into the mesendodermal fate
Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx
... containing 1% FCS and mixed vigorously The Hs0 016 4004_m1 COL1A2 Transient cell transfection and reporter gene assays COL1A1 Hs0 016 4099_m1 TIMP -1 Hs0 017 1558_m1 MMP -1 Hs00233958_m1 MMP-2 Hs00234422_m1 HsEEF1A1 ... Servet 1, 12 11 Geneva 14 , Switzerland 19 Received: 10 December 2009 Revised: April 2 010 Accepted: 29 April 2 010 Published: 29 April 2 010 21 20 ArthritisGoffin et al.;Therapy 2 010 , 12 :R73 under the ... strongly inhibited the production of type I collagen and TIMP -1 proteins induced by TGF- β (Figure 1d, e) TGF- β activates the transcription of COL1A1 and COL1A2 via AP2 and SP1 binding sites, respectively...
- 14
- 286
- 0
Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx
... protein in a highly pure form, and to Michel Léonetti (CEA, Saclay, France) for the monoclonal anti-Tat 7S and 11 S antibodies References 10 11 12 13 14 15 16 17 18 19 20 21 Strebel K: Virus-host interactions: ... strand (see the colour codes) With this first PCR, the exon1 sense strand partially hybridizes with the exon2 antisense strand and the exon1 antisense strand with the exon2 sense strand Then "Amplification ... TAATAATTCTAGAAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3 reverse for Tat1:← 17 18 and for Tat2:← 17 70) (11 1)NcoI rev 5' TATATACCATGGGGCACACACTACTTTGAGCACTCAAGG 3' (exon1:reverse:← 11 1) UTRTatNcoI rev 5' TATATTACCATGGTTCTTGCTCTCCTCTGTCGAGTAACG...
- 18
- 240
- 0
Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf
... into mammalian cells Mol Microbiol 56, 590–603 van der Goot FG, Tran van Nhieu G, Allaoui A, Sansonetti P & Lafont F (2004) Rafts can trigger 11 0 11 1 11 2 11 3 11 4 11 5 11 6 11 7 11 8 11 9 contact-mediated ... targeting and pore formation by the T3SS 10 0 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 426 P.-J Matteı et al ¨ The structure of Yersinia pestis V-antigen, an essential virulence factor and mediator of immunity ... supported by grants from the French Cystic Fibrosis Foundation (Vaincre la Mucoviscidose; VLM) and the Direction FEBS Journal 278 (2 011 ) 414 –426 ª 2 010 The Authors Journal compilation ª 2 010 FEBS 421...
- 13
- 647
- 0
Tài liệu Báo cáo Y học: Induction of (2¢)5¢)oligoadenylate synthetase in the marine sponges Suberites domuncula and Geodia cydonium by the bacterial endotoxin lipopolysaccharide docx
... – 1 10 10 10 – – 12 24 12 24 17 .19 66.25 25.77 28.07 56.80 60.70 57 .19 67 .11 37 .10 27. 21 38.60 39.47 32.86 30. 81 32. 21 26.77 45. 71 6.54 35.60 32.46 10 .50 8.49 10 .60 6 .12 82. 81 33.57 74.23 71. 93 ... – 1 10 10 10 – – 83.84 98.88 95.34 96. 61 97.78 98.78 97.80 98.90 16 .26 1. 12 4.66 3.39 2.22 1. 22 2.20 1. 10 1 10 10 10 – 98.48 96. 71 96.44 96.28 98. 41 97.93 98.38 1. 52 3.29 3.56 3.72 1. 59 2.07 1. 62 ... expression of the sponge, Geodia cydonium, Ó FEBS 2002 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 (2¢)5¢)Oligoadenylate synthetase in sponges (Eur J Biochem 269) 13 91 homolog of the human XPB/ERCC-3...
- 11
- 578
- 0
USE OF HEALTH AND NURSING CARE BY THE ELDERLY pptx
... 98 11 5 17 2 82 10 8 81 82 10 0 11 9 18 0 94 11 2 87 73 10 1 13 6 19 7 94 11 3 83 70 11 1 13 4 19 7 92 10 6 81 63 95 14 1 18 9 78 10 6 85 68 92 11 3 207 Total 99 11 2 11 0 10 5 10 4 99 10 7 10 1 10 8 10 6 10 0 10 0 10 6 10 6 ... 10 9 86 98 12 6 18 9 254 96 11 3 90 11 2 12 5 16 5 233 88 11 4 10 4 10 7 13 5 18 3 217 93 11 5 94 10 7 13 4 17 9 207 10 3 11 1 94 10 8 13 8 17 3 218 89 10 5 95 11 2 15 1 17 1 224 81 125 80 10 6 13 9 17 4 249 97 12 5 99 10 4 ... 9,7 11 ,4 17 ,0 25,6 5,6 6,9 7,7 13 ,2 13 ,7 19 ,4 19 ,0 4 ,1 11, 8 13 ,6 11 ,8 12 ,3 16 ,6 21, 6 11 ,8 4,8 12 ,0 10 ,3 12 ,1 17,0 21, 4 3,3 4,7 11 ,7 10 ,6 8 ,1 16,2 15 ,2 4 ,1 6,9 9,2 13 ,1 7 ,1 14,5 16 ,6 12 ,7 10 ,9 14 ,5...
- 127
- 488
- 0
Báo cáo khoa học: Oligosaccharide synthesis in Fibrobacter succinogenes S85 and its modulation by the substrate potx
... substrate, the rates of their utilization were 0 .10 lmolÆmg of protein )1 min )1 and 0.06 lmolÆmg of protein )1 min )1, respectively, while the rates were 0.05 lmolÆmg of protein )1 min )1 and 0.03 lmolÆmg ... France) (D) Glc1P, glucose -1- phosphate; MD1P, maltodextrin -1- phosphate; MD1Pa, Glc1P unit of MD1P; MD1Pb, Glc unit neighbouring the Glc1P of MD1P; MD, linear maltodextrins; MDt, the terminal Glc ... monitored by measuring the attenuance (D) at 600 nm and by succinate and acetate assays from 1H NMR spectra, respectively Maltodextrins of DP > were clearly metabolized by the cells, as shown by the...
- 12
- 406
- 0
Effects of compost and phosphate amendments on arsenic mobility in soils and arsenic uptake by the hyper
... fern 14 .6 1. 23ab 12 .4Æ0.98b 14 .4Æ2.31a 11 .6 1. 93b 20.7Æ 3.27c 31. 5Æ 2.43a 33.2Æ 3.21a 28.0Æ 1. 72b 16 .5 1. 83a 12 .4Æ0.31b 11 .5Æ0.69b 10 .1 1. 21b 40.5 Æ4.27a 31. 5 Æ3.21b 29.6 Æ2.33b 41. 7 Æ3 .11 a CCA, ... 1. 07b 18 .2 Æ2.59a 215 Æ 19 .3a 18 8Æ 21. 4b 19 2Æ 18 .7b 209Æ 23.5a 225a 227a 230a 221a 95.5a 82.8b 83.5b 94.6a AAC soil Control MSW BS PR 13 6 15 .9a 13 7 10 .9a 15 6 19 .8a 14 4 Æ6.52a 23.5 Æ3 .11 a 15 .4 ... 15 6 19 .8a 14 4 Æ6.52a 23.5 Æ3 .11 a 15 .4 1. 74b 7. 81 Æ0.27c 22.5 Æ2.62a 15 9Æ 16 .1a 15 3Æ 12 .3a 16 4Æ 13 .1a 16 6Æ 9.56a 17 1a 17 0a 16 8a 18 1a 93.0a 90.0a 97.6a 91. 7a a b CCA, chromated-copper-arsenate;...
- 11
- 707
- 0
By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx
... a time came down, and the nurse came down, and they ate a hearty breakfast Maria watched them, and hated them because they could eat while her 29 By the Light of the Soul mother was so ill Miss ... deposited the peaches in the ice-box, and had been about to enter the room, retreated He went out the other door himself, and round upon the piazza, when presently the smoke of his cigar stole into the ... some cologne on the handkerchief and a pungent odor filled the room She laid the wet handkerchief on her mother’s sallow forehead, then she recoiled, for her mother, at the shock of the coldness,...
- 488
- 398
- 0
Guidance for Industry on Complementary and Alternative Medicine Products and Their Regulation by the Food and Drug Administration pptx
... Alexander technique, Feldenkrais method, and a host of others Manipulative and body-based practices focus primarily on the structures and systems of the body, including the bones and joints, the ... begin by understanding the Act's statutory definitions or, in the case of the PHs Act, our authority regarding biological products "Drug" and "New Drug" Section 2 01( g)(l) of the Act ( 21 U.S.C 3 21( g)([l))defines ... Biologics Evaluation and Research, Food and Drug Administration, 14 01 Rockville Pike, Rockville, MD 20852 -14 48, 1- 800-835-4709 or 3 01- 827 -18 00 For cosmetics, the Office of Cosmetics and Colors, Center...
- 17
- 470
- 0
Báo cáo khoa học: Par j 1 and Par j 2, the two major allergens in Parietaria judaica, bind preferentially to monoacylated negative lipids potx
... presence and absence of the ligand, is 8.5, 13 and 87 for rPar j 1, rPar j and nPar j 1 Par j 2, respectively Although the Kd value could only be accurately determined for the complex Par j 1 OLPC by ... 9 .1 ± 1. 2 lm compatible with a : complex This value compares well with the Kd calculated for lysophospholipids and other ns-LTPs Kd values of 10 .1 lm and 1. 9 lm were obtained for lyso-C16 (1- palmitoyl-l-a-lysophosphatidylcholine) ... 000 C 20 000 15 000 10 000 5000 15 000 10 000 5000 10 [dithiothreitol] (mM) 12 Fig CD signal recorded at 222 nm and 10 °C after 15 h of incubation with varying concentrations of the reducing...
- 14
- 440
- 0
Báo cáo khoa học: Hodgkin Reed–Sternberg cells express 15-lipoxygenase-1 and are putative producers of eoxins in vivo Novel insight into the inflammatory features of classical Hodgkin lymphoma ppt
... reticulocytes and mast cells [6 ,18 –20] The Th2 cytokines IL-4 and IL -13 induce the expression of 15 -LO -1 in monocytes, airway epithelial cells and mast cells [20–23] Demethylation of the 15 -LO -1 promoter ... in L1236 cells, which express 15 -LO -1, and L428 cells, which not express 15 -LO -1, is different because only L1236 express 15 -LO -1 The expression of 15 -LO -1 and putative formation of eoxins by ... determined Patient number HL 10 11 12 13 14 15 16 17 18 19 20 NHL 21 22 23 24 25 26 27 28 29 30 Sex Age (years) Clinical stage Tumor EBV status H-RS cells Eosinophilia 15 -LO -1 expression Male Female...
- 13
- 350
- 0
Báo cáo khoa học: Binding of the viral immunogenic octapeptide VSV8 to native glucose-regulated protein Grp94 (gp96) and its inhibition by the physiological ligands ATP and Ca2+ Ming Ying and Torgeir Flatmark pot
... increment for the analyte and ligand, respectively Similar (dn ⁄ dc) values have been determined for bovine serum albumin (0 .19 0 cm3Æg )1) and alanine (0 .19 2 cm3Æg )1) [14 ], and the same value was therefore ... ðMr;analyte =Mr;ligand ÞnðAÞRimmobilized 1 where Mr,analyte and Mr,ligand are the relative molecular mass of the analyte and ligand, respectively; n is the number of analyte-binding sites on the protein; ... signal (Fig 2C), and the response isotherm gave a [A]0.5 of 16 8 lm Although Grp78 ⁄ BiP and Grp94 are the two major recipients of the pool of ATP translocated into the lumen of ER [24] the effects...
- 10
- 304
- 0
The 2012 Competition of Master Degree Theses on Economics and Finance Organised by the Centre des Professions Financières, Paris pot
... send 10 theses If more theses are received, the organiser reserves the right to eliminate the extra theses according to his own choice and before the transmission to the jury • The Centre and ... part or all of the submitted theses After the end of the process, the nominees’ theses could be diffused or published in whole or in part by the Centre and/ or by the partners of the competition, ... its application and the quality of the conclusion The thesis should be clear and articulate • The subject and form of the thesis are the student’s choice The thesis must be written in French or...
- 5
- 301
- 0
báo cáo hóa học:" Effects of TGF-β1 and IGF-1 on proliferation of human nucleus pulposus cells in medium with different serum concentrations" pptx
... 10 %FBS, 10 0 μg/L IGF -1, the morphology of NP cells were similar to the 10 μg/L TGF- 1 group ( 10 0) Figure 11 The morphology of human NP cells under 10 %FBS conditions The morphology of human NP cells ... under 1% FBS conditions The morphology of human NP cells under 1% FBS conditions 1% FBS, 10 μg/L TGF- 1, NP cells were similar to the normal NP cells with regular spindle-shape ( 10 0) Page of 11 (page ... percence of TGF 1, IGF -1 and TGF- 1+ IGF -1 on cell proliferation was calculated as 72.4% (P < 0.0 01) , 50.6% (P < 0. 01) , and 86% (P < 0.0 01) respectively The total amount of cell proliferation by growth...
- 11
- 605
- 0
European Research on Environment and Health Funded by the Sixth Framework Programme pdf
... the most pronounced indoor air health-related outcomes, then determines the main exposures, causes and sources and thereby outlines the most relevant policies • Identify the most widespread and ... Identification of the technology development and deployment needs in the area of air pollution and health impact mitigation, for the Environmental Technology Action Plan and the Thematic Strategy on the Urban ... measures and their costs for PCBs, dioxins and indoor air pollution, review of existing information for ozone and heavy metals, and the evaluation of the health and non-health benefits of these...
- 50
- 291
- 0
I am malala the girl who stood up for education and was shot by the taliban malala yousafzai
... Earrings and Pashtuns Don’t Say Thank You Children of the Rubbish Mountain The Mufti Who Tried to Close Our School The Autumn of the Earthquake PART TWO: THE VALLEY OF DEATH 10 11 12 13 14 15 Radio ... very poor My father and a friend had founded their first school and we lived in a shabby shack of two rooms opposite the school I slept with my mother and father in one room and the other was for ... his picture on them These clerics said 9 /11 was revenge on the Americans for what they had been doing to other people round the world, but they ignored the fact that the people in the World Trade...
- 197
- 818
- 0
An investigation into the pronunciation of the fricatives θ and ð experienced by the students of grade 10th at thanh binh 2 high school – problems and solutions
... Taught 13 0 92.9% 10 7 .1% Fink – Think 0% 14 0 10 0% Bat- Bath 1. 4% 13 8 98.6% Dare- there 13 9 99.3% 0.7% Breathe - Breed 11 2 80% 28 20% Clothe- close 10 7 .1% 13 0 92.9% That – Vat 0% 14 0 10 0% The table ... researcher 10 cb1, researcher recorded 10 cb2, students’/θ/, 10 cb3, 10 cb4 the /ð/ pronunciation performed by 10 cb1, 10 cb2, 10 cb3, 10 cb4 Step 4: Analyzing the data and write the report ( 31/ 03/2 012 – 5/05/2 012 ) ... minimal pairs 11 /03 The students The of Pre recording 10 cb1, researcher The researcher recorded the 10 cb2, four classes by 10 cb3, 10 cb4 recorder program 13 - 14 / 03 The two The Observation The researcher...
- 68
- 752
- 0
Báo cáo y học: "Traditions and plant use during pregnancy, childbirth and postpartum recovery by the Kry ethnic group in Lao PDr" potx
... 2;3 1; 2;3 2;3 1; 2;3 1; 2;3 2;3 1; 2;3 1; 2;3 2;3 2;3 2;3 1; 2;3 1; 2;3 1; 2;3 2;3 1; 2;3 Lamxay et al Journal of Ethnobiology and Ethnomedicine 2 011 , 7 :14 http://www.ethnobiomed.com/content/7 /1/ 14 Table ... (Figure 4) At the onset of labor, the mother and her husband will move to the makeshift hut, and remain there for delivery Direct relatives take care of the couple’s other children The mother gives ... washing the neonate Medicinal plants are collected either by the husband in the vicinity of the hut, or supplied by relatives if collected from further away The mother is not allowed to bathe or...
- 15
- 489
- 0
Báo cáo y học: "TGF-β1 and serum both stimulate contraction but differentially affect apoptosis in 3D collagen gels" ppt
... ± 1. 1% of their initial area (Figure 1) In contrast, gels exposed to FCS (0 .1% or 1% ) were 21. 6 ± 1. 0% and 13 .1 ± 0 .1% of their original size after d, respectively (Figure 1) Gels exposed to TGF- 1 ... http://respiratory-research.com/content/6 /1/ 1 41 120 % of TUNEL positivity 10 0 80 60 * 40 * 20 FC S 1% 10 0p M TG F 1 10 0p M 10 pM 10 0p M G FBB PD TG F 1 1% TG Fβ FC S 1% FC S M EM SF -D D N A se tr ea ... 6 :14 1 SF FCS 1% TGF- 1 β 10 0pM http://respiratory-research.com/content/6 /1/ 1 41 Stauro 1 M µ SF Bax β-actin Intact PARP Cleaved PARP FCS 1% TGF- 1 β 10 0pM Stauro 1 M µ Bcl-2 β-actin cIAP1 β-actin...
- 12
- 330
- 0
Báo cáo y học: "HIV-1 and recombinant gp120 affect the survival and differentiation of human vessel wall-derived mesenchymal stem cells" pot
... muscle and endothelial cells To study the effects of HIV -1 on the differentiation of these cells, the interaction of HIV -1 and recombinant gp120 on MSC differentiation to adipogenic and endothelial ... HIV -1 IIIb , 5.8 ± 1. 4 p < 0.05 with HIV-1ada and 4.7 ± 1. 3 p < 0.05 with gp120) and δ (3.6 ± 1. 2, p < 0.05 with HIV -1 IIIb, 3.4 ± 1. 3 p < 0.05 with HIV-1ada and 3.5 ± 0.9 p < 0.05 with gp120) ... and to a lesser extent at day (10 .3 ± 1. 4% and 10 .1 ± 1. 2% in the HIV-1IIIb or HIV-1ada infected samples respectively, in comparison with 5.2 ± 0.4% in the mock-infected cultures; p < 0.05) The...
- 18
- 247
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25