acquirer the criterion described in section a above shall preferably be considered failing that the criterion included in section b shall be used

The Art of Public Speaking cylinder, piston, water, and fire, is the steam−engine in its most elementary form. For a steam−engine may be defined as an apparatus for doing work by means of heat applied to water; and since raising such a weight as the pisto

Ngày tải lên : 08/08/2012, 17:20

5
1.3K
3

Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf

Ngày tải lên : 08/03/2014, 10:20

... varia (alfalfa), Arabidopsis thaliana, Oryza sativa (rice), Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, and mammals Combining the ASBD and pro®les with a variable linker between ... from the glutathione±Sepharose beads (A) Binding of rat Ba ASBD and 2; (B) binding of human PR72 ASBD and SV40 small t antigen and truncation m#3 were used for a speci®city control The data shown ... have shown that intrarepeat loops are binding sites for different types of B subunits [13,27] Substitution of certain amino acids in the intrarepeat loops abrogates the binding of some B subunits...

7
550
0

Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps

Ngày tải lên : 10/08/2014, 09:21

... showing complete replacement of ascending aorta and aortic arch, the FET in the descending thoracic aorta and the saphenous vein grafts originating from the ascending aorta (b. ) Axial CT image ... and muscle relaxant Invasive monitoring included the use of right radial and left radial arterial lines, a pulmonary artery catheter and a foley catheter with temperature probe to measure bladder ... temperature of 25°C Upon cardiac fibrillation, a crossclamp was placed across the ascending aorta and resected above the coronary ostia in the sinotubular junction Myocardial arrest was achieved...

5
571
0

Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps

Ngày tải lên : 11/08/2014, 21:21

... GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’, resulting a product of 550 bp; and b- actin forward 5’ TGGGTCAGAAGGACTCCTATG 3’ and reverse 5’ AGAAGAGCTATGAGCTGCCTG ... Wambach M, Katze MG, Krug RM: Binding of the influenza virus NS1 protein to double-stranded RNA inhibits the activation of the protein kinase that phosphorylates the elF-2 translation initiation ... washed before the addition of the tetramethyl benzidine (TMB) substrate solution, after which the strips were incubated for 15 at room temperature in the dark The reaction was terminated by the...

8
348
0

Báo cáo y học: " Comparison of the efficacy of lamivudine and telbivudine in the treatment of chronic hepatitis B: a systematic review" pdf

Ngày tải lên : 12/08/2014, 01:21

... varies greatly in different parts of the world Based on the prevalence of HBV surface antigen(HBsAg) carrier rate in the general population, sub-Saharan African, East Asian and Alaskan populations ... the trials was assessed using the QUOROM guidelines as well as using the Jadad scale[12] Data analysis Data analysis was carried out with the use of Review Manager Software 5.0(Cochrane Collaboration, ... significant difference in the HBeAg seroconversion and HBsAg response However, the difference between one-year treatment and two-year treatment was that LdT was better than LAM at the HBeAg seroconversion...

11
398
0

Báo cáo khoa học: "Use of prophylactic fluconazole in a neonatal intensive care unit: efficacy is similar to that described in adult high-risk surgical patients" ppsx

Ngày tải lên : 12/08/2014, 23:21

1
259
0

STUDY, ASSESSEMENT OF BIOCLIMATIC RESOURCES IN THE NORTHEAST REGION OF VIETNAM FOR DEVELOPMENT OF a FEW AGRICULTURAL CROPS AND FOREST TREES THAT HAVE ECONOMIC VALUE

Ngày tải lên : 29/08/2014, 15:53

... types obtained by various authors in the country, analyzing the advantages and disadvantages of these methods of bioclimate classfication so that the author can select most appropriate classification ... for a long time and tracks the impact of weather each day, each month, studying climate within the region and in each small area (micro-climate), in landscape and barn equipment created by humans ... bioclimatic type IE1c (>200m), IIC 2b with a total point rate (9/15); The bioclimatic types IIA 2a, IIB 2b, IID 2b, IIIC 3b a total point rate (8/15); The bioclimatic types IIA 2b, IIIA 3a, IIIA 3b, IIIB 3b, ...

28
384
0

Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf

Ngày tải lên : 21/12/2013, 19:15

... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface ... interface command can also be used to display information about the B channel: Tokyo#show interface bri Upon completion of the previous steps, finish the lab by doing the following: • • Turn the router ... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced...

8
419
0

Tài liệu Báo cáo khoa học: Steﬁn A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Ngày tải lên : 18/02/2014, 04:20

... hydrogen bond between the stefin A A49 amide and cathepsin B G24 carbonyl The binding of this loop is further stabilized by a hydrogen bond between the stefin A N52 side chain amide and the cathepsin B ... (Fig 2) These additional features hinder binding along the whole interdomain interface, although they both are displaced upon binding of the ligand The N-terminal trunk and the first binding loop ... can bind certain ligands along the whole interdomain interface During docking, size alone most likely plays no role Cathepsin B will accept inhibitors or substrates, whatever is available FEBS...

8
632
0

Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf

Ngày tải lên : 19/02/2014, 16:20

... determine whether the insect AFPs Asn residues are also somehow involved in ice binding Both sbwAFP and TmAFP have a capping structure at one terminus In the case of sbwAFP, the cap is at the C-terminus ... fold A comparative structural analysis cannot be made easily between TmAFP and other, right-handed b- helical proteins, because all other known right-handed b- helical proteins have coils that consist ... proposed that these b- helical proteins are rigid most probably because of the extensive network of hydrogen bonds between the coils and the favourable van der Waals interactions between stacked...

12
716
0

Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx

Ngày tải lên : 19/02/2014, 16:20

... transcriptional enhancing activity were found in the intergenic region between the Ig -b and GH genes A member of the OCT family transcription factors appeared to be involved in the transactivation of the ... fragment hybridizable with the probe is shown below the map Exons and introns are indicated as in Fig (B) Genomic Southern hybridization HindIII digested DNA (2.5 lg) was separated by 0.75% agarose ... clones by PCR and tamoxifen treatment To determine homologous recombination, PCR was carried out as described [45] using the following primers: 5¢CGATTGAAGAACTCATTCCACTCAAATATACCC-3¢ (in Bsr gene)...

11
638
0

Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot

Ngày tải lên : 17/03/2014, 17:20

... not activate a- lysine or arginine (b- arginine not tested) This indicates that the active site of the enzyme can strictly distinguish between an a- amino and a b- amino group of lysine Other b- amino ... the gene We found that S noursei contains a stand-alone A- domain that activates b- lysine by adenylation It was also found that S noursei harbours a protein that after activation speci®cally binds ... when incubated with tritium-labelled b- lysine, ATP and MgCl2 did not bind the labelled amino acid covalently, which indicates that the enzyme most probably represented a stand-alone A- domain without...

11
559
0

The a and b adapters are used as priming sites for both amplification

Ngày tải lên : 19/03/2014, 22:32

... attach to DNA rich beads only • A magnetic field filters all DNA rich beads from empty beads, and then extracts the biotin beads from the DNA rich beads • The DNA in the beads are denatured again ... for both amplification and sequencing since their composition is known • The B adapter contains a 5’ biotin tag used for mobilization • The beads are magnetized and attract the biotin in the B adaptors ... added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in place • Above the wells is a flow channel, passing nucleotides and apyrase in a timed schedule...

19
390
0

Báo cáo khoa học: X-ray structure of glucose/galactose receptor from Salmonella typhimurium in complex with the physiological ligand, (2R)-glyceryl-b-D-galactopyranoside pdf

Ngày tải lên : 23/03/2014, 04:21

... in the binding site (A) Stereoview of bound GGal showing GBP residues making hydrogen-bonding and aromatic interactions (B) Schematic diagram of the hydrogen bonds between GBP and GGal Interactions ... glucose-binding protein has been identiﬁed in some bacteria; its fold is not similar to GBP, but rather to that of the larger maltose-binding protein This kind of protein is exempliﬁed by the Thermus thermophilus ... Sooriyaarachchi et al changes observed must be relevant both to the closing that traps bound sugars, and the opening required for a ligand’s release into the membrane-bound components of the ABC transport...

9
360
0

Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot

Ngày tải lên : 24/03/2014, 04:21

... implies that not only the furanosidic linkage is acid-labile, but also that of the b- D-GalNAc residue Thus, assuming that the linkage second most easily hydrolyzed is that of the acetamidohexose, the ... sugars and acidic sugars are frequent Furanosidic sugars are also observed Neuraminic acid has been found once but only as an internal residue Of the more than 60 E coli strains that have been investigated, ... mode was run on a Finnigan Lasermat instrument using dihydroxybenzoic acid acid as matrix Between 10 and 20 scans were accumulated and added The neuraminic-acid-free polysaccharide was treated...

7
463
0

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Ngày tải lên : 28/03/2014, 23:20

... (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantiﬁcation of the splicing ratio by RT-PCR was performed using the forward primer radiolabeled ... ISSs The score was obtained by analyzing 52 HBV genomes on the RNAz webserver (http://rna.tbi.univie.ac.at/cgi-bin/RNAz.cgi) The double asterisk indicates P < 0.001 in a t-test between the HBV ... (http://www.r-project.org) The broken line and box (black) represent the distribution of MFE values of the HBV genome background against each ISS The bold line in the box represents the median of the MFE values The box...

14
379
0

Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx

Ngày tải lên : 18/06/2014, 22:20

... 250 bp upstream of the I7L ORF, to include the native promoter, and to aid in homologous recombination This plasmid was used to create the recombinant virus vtetOI7L using the transient dominant ... the immature virus along with the accompanying DNA and other viral proteins, then activation of I7L leads to the process of core protein precursor cleavage and the initiation of core condensation ... the paper Both authors read and approved the final manuscript Acknowledgements We kindly thank Dr Paula Traktman for the vTetR virus strain and for helpful discussions, Tove' Bolken and Dr Marika...

6
300
0

Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc

Ngày tải lên : 20/06/2014, 01:20

... topological shifts for each of the recombinants have strong bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs ... of the three putative recombinant viruses were derived by plaque purification Furthermore, the same laboratory was the source for all four recombinants and the one putative parental strain As ... Spackman E, Alexander DJ: Recombination resulting in virulence shift in avian influenza outbreak, Chile Emerg Infect Dis 2004, 10:693-699 Gibbs MJ, Armstrong JS, Gibbs AJ: Recombination in the...

3
282
0

báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx

Ngày tải lên : 20/06/2014, 04:20

... 250 bp upstream of the I7L ORF, to include the native promoter, and to aid in homologous recombination This plasmid was used to create the recombinant virus vtetOI7L using the transient dominant ... the immature virus along with the accompanying DNA and other viral proteins, then activation of I7L leads to the process of core protein precursor cleavage and the initiation of core condensation ... the paper Both authors read and approved the final manuscript Acknowledgements We kindly thank Dr Paula Traktman for the vTetR virus strain and for helpful discussions, Tove' Bolken and Dr Marika...

6
208
0

báo cáo hóa học:" Psychometric properties of the DISABKIDS Chronic Generic Module (DCGM-37) when used in children undergoing treatment for cancer" pdf

Ngày tải lên : 20/06/2014, 16:20

... effects from treatment compared to other diagnoses Children with sarcomas receive combination therapy including surgery, chemotherapy and radiation therapy and are often described as a group with ... satisfactory data quality and generally acceptable psychometric properties in children undergoing treatment for cancer Data quality was satisfying with overall acceptable amount of missing values ... their parents Data quality was evaluated by examination of the amount of missing item responses [14] Up to 10% missing responses has been suggested as acceptable [16] The legitimacy of adding up...

7
461
0