access a program element that has the same name as a keyword
Mixing up Words That Look the Same
... still has the same childish wonder about science that he had as a boy Say Instead: Dr Levin still has the same childlike wonder about science that he had as a boy Here’s Why: “Childish” and “childlike” ... Say: The song was a eulogy mourning the death of his father Say Instead: The song was an elegy mourning the death of his father Here’s Why: An “elegy” is a song or poem that mourns one who has ... luxuriant) blond curls, but she was a brunette with a crew cut 27 The crew’s (moral, morale) was sinking as fast as the ship 28 The story’s (moral, morale) was clear: never irritate a gorilla 194...
- 16
- 334
- 0
Mixing up Words That Sound the Same
... angry at an (amoral, immoral) force such as a tornado It may be as easy as taking candy from a baby, but it’s also just as (amoral, immoral) I’ve suffered few (averse, adverse) (affects, effects) ... of the “annual” in “biannually” as a reminder that you’re talking about a single year’s worth of time Here are two other correct examples: The biannual status report comes out each January and ... tact makes Mr Stevens a terrible diplomat Don’t give up; try another tack first 96 Tortuous vs Torturous Don’t Say: That dental examination was tortuous Say Instead: That dental examination was...
- 12
- 424
- 0
C H A P T E R 35 P Types of Poems Poetry POETRY SHARES many of the same elements as fiction, but doc
... that plays should acknowledge that they are plays and should not attempt to be realistic At the same time, they attempt to portray human nature as realistically as possible As a result, the antihero ... Tante Atie? a They are sisters b They are friends c Tante Atie is the narrator’s guardian d Tante Atie is the narrator’s mother b Tante Atie is the narrator’s teacher 27 What is happening to the ... And having perhaps the better claim, Because it was grassy and wanted wear; Though as for that the passing there Had worn them really about the same, Elements of Sound Though not all poems use...
- 48
- 572
- 0
Question 6: Rerwite the following sentences that keep the same meaning. pot
... the first time last year 10 I have no intention of giving you any more money It is such a hard cake that I can’t eat it Because the weather was bad, we had to stay at home 3 Carol congratulated ... as a translator ? - Is his I lent my car to that man - That s As I get older, I want to travel less - The older Their teacher is making them to study hard - They are It’s thought that the ... exam He told me the answers The boy I ……………………………………………………… It is such a hard cake that I can’t eat it Because the weather was bad, we had to stay at home Carol congratulated Rol on passing his driving...
- 16
- 750
- 1
Báo cáo y học: "Two different genomes that produce the same result" docx
... Plasmodium falciparum In this case too, transcriptional regulation has been difficult to study in detail, although recently a family of AP2 (Apicomplexan apetala2) transcription factors have been ... Tsugita A: Change of a sequence of amino acids in phage T4 lysozyme by acridine-induced mutations Proc Natl Acad Sci USA 1966, 56:500-507 Parikh A, Miranda ER, Katoh-Kurasawa M, Fuller D, Rot G, Zagar ... expressing another, exactly at the time they switch from being unicellular to being multi cellular Parikh et al [2] now show that the cells alter the abundance of almost every mRNA in the transcriptome...
- 3
- 288
- 0
Complete the second sentence so that means the same as the first
... you like a glass of wine?”, he said 28 They changed their plan because the weather was bad Due to bad weather, they changed their plan 29 The increasing number of cars has caused serious air pollution ... “Don’t walk on the grass”, the gardener said to us The gardener told us not to walk on the grass 21 Somebody repaired her car yesterday She had her car repaired 22 You must see the manager tomorrow ... eleven she can meet him 25 There was never any answer when he rang Every time he rang there wasn’t any answer 26 No one expected his coming He wasn’t expected to come 27 He offered ma a glass of wine...
- 2
- 1,092
- 2
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... identical patterns and it was therefore concluded that the same polysaccharide was present A hydrolysate of the upper phase, analyzed as alditol acetates, revealed as D-glucose, D-galactose, D-galactosamine, ... an upper phase, the latter containing most of the material SDS/PAGE of the two materials Fig SDS/PAGE of the upper phase (1) and the pellet (2) obtained on ultracentrifugation of the Hafnia alvei ... in Hafnia has not been observed before It was not clear whether it was an lipopolysaccharide or a capsular polysaccharide and the fraction was not further investigated The proportion of the minor...
- 7
- 463
- 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... (commercially known as „AlgaeCal‟ or „AC‟) made by milling whole, live-harvested sea algae found on the South American coastline In addition to calcium, the algae contained other naturally occurring ... had an average age of 57.4 (41-89) which is consistent with the age-related decline of 1% to 2% cited above for women of menopausal age as well as with the data reported in the meta-analysis As ... following all three plans had an increase in MAPC: Plan 1=1.30%, Plan 2=2.00%, and Plan 3=4.1% Using a repeated-measures t-test, the MAPC from baseline in all three Plans was significant (P=0.003,...
- 12
- 663
- 0
Tài liệu Create a Class That Implements the Interface You Defined docx
... declaration Doing so inserts the appropriate End tag When all the tags are in the class, Intellisense is reenabled 19 Add private variables directly below the class declaration to store class data, ... mstrCompanyName As String Private mstrContactName As String Private mstrContactTitle As String Private mstrAddress As String Private mstrCity As String Private mstrRegion As String Private mstrCountry ... PropertyName() As String PropertyName = mstrClassVariable End Property Public Property Let PropertyName(ByVal strValue As String) mstrClassVariable = strValue End Property In Visual Basic NET, the...
- 9
- 325
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... biochemical characterization classifies it as a 6-phytase There is another hydrogen bond of this particular phosphate group with Arg267 in AppA The corresponding Arg262 in PhyK has a different side chain ... smaller than for AppA, showing that binding is favored by the preformed site By contrast, catalysis by AppA is faster, as reflected in the values for kcat ⁄ Km, indicating that a conformationally flexible ... Klebsiella sp ASR1 (PhyK) is a 3-phytase with myo-inositol 2-phosphate as the final product [14] A virtually identical phytase from Klebsiella terrigena has also been described [6] PhyK contains both the...
- 13
- 766
- 0
Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc
... reported as far back as 1965) CPI components exhibit a wide range of growth rates, although none are as high as naval ship escalation rates The highest, and the closest to naval ship rates, is that ... Congress Cataloging-in-Publication Data Arena, Mark V Why has the cost of Navy ships risen? : a macroscopic examination of the trends in U.S Naval ship costs over the past several decades / Mark V Arena, ... type (carrier, surface combatant, etc.) was assumed to be the same as the 2005 values in Table 1.1 (e.g., a new carrier would cost approximately $6.1 billion) For each year, we escalated that cost...
- 124
- 583
- 0
Tài liệu Why Has the Cost of Fixed-Wing Aircraft Risen - A Macroscopic Examination of the Trends in U.S. Military Aircraft Costs over the Past Several Decades pptx
... Navy asked RAND to examine the causes of military aircraft cost escalation From available data, we calculated cost escalation rates as well as their “economy-driven” and “customer-driven” causes ... increased in cost at roughly the same rate as other measures of inflation Altogether, we find that labor, material, equipment, and manufacturer fees and profits have helped increase the cost of aircraft ... cost data in our database Data and Price Trends which was not surprising given that the HAPCA and CBO dataset were built from the original P-1 documents.5 Technical and Schedule Databases To...
- 118
- 543
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... For the latter type of enzyme, it has been shown that mutation of aspartic acid to asparagine leads to a drastic acidic shift of the pH optimum [35] Indeed, LlChi1 8A was found to have an acidic ... degradation of a- chitin by LlChi1 8A started with a rapid phase, regardless of the presence of LlCBP3 3A In the presence of LlCBP3 3A, the fast initial phase was maintained longer than in the absence ... instructions, containing ends compatible with the expression vector (forward primer, 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product...
- 14
- 683
- 0
Đề tài " A five element basis for the uncountable linear orders " doc
... In particular if X is a set of reals of cardinality ℵ1 , then X serves as a single -element basis for the class of uncountable separable linear orders PFA is a strengthening of the Baire Category ... M is in A ∪ B Further, we may assume that Y (M ) has the same fixed size n for all M in B and that are a ζ0 and E∗ ∈ E such that: (16) If M is in B, then diff(Y (M )) ⊆ ζ0 684 JUSTIN TATCH MOORE ... + MAℵ1 ) There are no A, B, and Y which satisfy the conclusion of Lemma 5.24 In particular, ∂(K) is canonically proper Proof We will assume that there are such A, B, and Y and derive a contradiction...
- 21
- 410
- 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx
... donors and nitrate, in each case for several ranges of time (0.5–5 s) The traces obtained are shown in Fig They are monophasic and fit a decreasing exponential equation The amplitudes obtained agree ... to these obtained by Zhao et al [15] These authors found four phases in the reduction of the cytochrome by menadiol, phases arbitrarily Use of a mutant (pVA700-C16) whose nitrate reductase has ... cells The supernatant was further centrifuged for 90 at a maximum of 120 000 g, and the new supernatant was discarded while the pellet was retained All of these procedures were performed at °C The...
- 8
- 442
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... cysteine acid proteases, are central regulators of apoptosis [12,13] Caspases are routinely used as a measure of apoptosis, in contrast to necrosis Caspase activation occurs at the intersection of all ... collected and counted using trypan blue staining and ⁄ or cell viability assay kit (Promega) Caspase (3 ⁄ 7) activity was measured according the manufacturer’s instructions using the Caspase-Glo3 ⁄ assay...
- 12
- 561
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... Neoplastic transformation has been shown to stabilize ARE-containing mRNAs [68] and has been associated with the activation of c-Jun N-terminal kinase (JNK) [69] Similarly, activation of MAP kinase-activated ... was cloned in frame via the BamHI and SmaI sites downstream of the GST (glutathionine S-transferase) gene into GEX-2T (Amersham-Pharmacia) and was called pGEX-HuD pGEX-HuR was constructed in a...
- 16
- 754
- 0
FOREST AND PAPER INDUSTRY - A mature industry that has done much to clean up its act. pptx
... as avoidance: The issue of “paper vs plastic” Paper bag vs plastic bag at grocery store Paper cup vs polystyrene cup In each case, the life-cycle analysis shows that the non-paper choice is the ... air pollution Instead, these remainders can easily and economically be turned into paper Scrap material such as the leftovers from the manufacturing of denim jeans, or old money can also create ... recycled, such as archives and libraries, and papers used in construction materials (eubusiness.com) Same data displayed graphically 20 Corrugated cardboard boxes: Generated waste: 29.7 million...
- 25
- 222
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008