0

a useful model to determine the most efficient microorganism

APPLICATIONS OF IMMUNOCYTOCHEMISTRY pot

APPLICATIONS OF IMMUNOCYTOCHEMISTRY pot

Điện - Điện tử

... Diseases: An Immunocytochemical Approach 249 Alejandra Kun, Gonzalo Rosso, Luc a Canclini, Mariana Bresque, Carlos Romeo, Karina Cal, Aldo Calliari, Alicia Hanuz, José Roberto Sotelo-Silveira and José ... is a crucial weakness The availability of the specific antiserum is limited to the lifespan of the animal – after the last batch the animal produced is exhausted, the antibody is virtually lost, ... all available epitopes Theoretically, the affinity of the antibody for its target is far greater than the affinity of the blocking protein for that same region Furthermore, the affinity of the antibody...
  • 330
  • 233
  • 1
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

Báo cáo khoa học

... A A A P – pS P P P P A A – P A S A A A P A A A A A A A mK K K K K aK – A A A A A A A K K K K K K amK A A P A A A R K K K K K K pS A A A A A A pS T T T T T T T K K K K K K A K K K K K K K K K K ... variation acting as a marker for a particular phenotype However, the main aim of Sarg et al [34] was to demonstrate the use of a particular chromatography technique, rather than to firmly establish ... human and mouse were taken from [43], and the data for chicken were taken from [44] Chicken H101 H110 H102 H103 H11L H11R H5 a- S a- S a- S a- A a- S a- A a- pT T T T pT T pT pS A A A A A A A A A A A P...
  • 13
  • 633
  • 0
báo cáo khoa học:

báo cáo khoa học: " Manufacture of IRDye800CW-coupled Fe3O4 nanoparticles and their applications in cell labeling and in vivo imaging" ppt

Báo cáo khoa học

... 3-dimercaptosuccinic acid (DMSA) has often been used as a coating on nanoparticles to improve their water solubility [43-46] DMSA-coated nanoparticles have abundant carboxyls on their surface [47-49], ... EDC was added and sonicated for 40 to activate the carboxyl groups on the surface of the nanoparticles The solution was centrifuged at 12000 rpm for 10 and the precipitate was Hou et al Journal ... 14 Lacava LM, Garcia VAP, Kuckelhaus S, Azevedo RB, Lacava ZGM, Silva O, Pelegrini F, Gansau C, Buske N, Morais PC: Magnetic resonance and light microscopy investigation of a dextran coated magnetic...
  • 14
  • 399
  • 0
Intein mediated generation of n terminal cysteine proteins and their applications in live cell bioimaging and protein microarray

Intein mediated generation of n terminal cysteine proteins and their applications in live cell bioimaging and protein microarray

Tổng hợp

... TCC AAC TGC AGA GCC atg tcc cct ata cta- 3’ 5’-GGT GGT CTG CAG tca gtc acg atg cgg-3’ 19 pT-Rex-DEST30-intein/EGFP 5’-GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG GCT ATC ... glutathione was conjugated with Cy3-NHS (Amersham Pharmacia, USA) for 1h in 0.1M NaHCO3, pH according to the manufacturer’s protocol and purified through a NAP-5 column (Amersham Pharmacia, USA) ... 1987 and more than 100 inteins are listed to date.[2,3] Inteins have been found in organisms from eubacteria, archaea, and eucarya, as well as in viral and phage proteins They are predominantly...
  • 77
  • 200
  • 0
Aspects of carbohydrate quality and their relevance for risk markers of type 2 diabetes and related health outcomes

Aspects of carbohydrate quality and their relevance for risk markers of type 2 diabetes and related health outcomes

Tổng hợp

... special needs and adapted to metabolic alterations related to aging are becoming indispensable Taken together, prospective data on the relevance of carbohydrate quality on the risk of T2D and related ... total daily energy from carbohydrates was questioned and it was emphasized that the nature of dietary carbohydrates appears to be more important than the total intake [22] Likewise, the German ... (HOMA-IR), alanine-aminotransferase (ALT), and gamma-glutamyltransferase (GGT) in a subsample of the DONALD Study (n=226 and n=214, respectively) In Study III, again based on data from the DONALD...
  • 203
  • 431
  • 0
GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC

GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC

Sinh học

... receptor associated with malignant hyperthermia Animal Science 253: 448-451 Hanset, R, S Scalais, L Grobet (1995) From the classical type Piétrain to Halothane-resistant Piétrain, or Piétrain-RéHal ... actual ages of animals (days) at measurement were added in the model as a covariate For the sperm quality, the different genetic groups and the seasons (Spring, Summer, Autumn and Winter) were the ... pen The training of the young boars was started from 8.5 months of age The interval between two collections was to days Animal husbandry was identically applied to all groups All pigs were reared...
  • 6
  • 734
  • 0
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Môi trường

... Osaka, Kobe, Hiroshima, and others Therefore, it is considered that a large amount of pollutants runs into the sea from the urban as well as industrial areas As the area around the Seto Inland ... in detail and material balances around reservoirs were considered RESEARCH PROCEDURE Location: Matsuyama region and periphery of the Seto Inland Sea The location of the research area and the distribution ... REFERENCES American Public Health Association (APHA)/American Water Works Association (AWWA)/Water Environment Federation (WEF) (1998) Standard Methods for the Examination of Water and Wastewater,...
  • 10
  • 717
  • 0
A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

Khoa học xã hội

... features and making a contrastive analysis to find out the similarities and differences between the syntactic features of ESVs and VSVs - Analyzing data of ESVs and VSVs in terms of the semantic ... up, most of the syntactic features of SVs are analyzed basing on the theoretical background by Quirk et.al [33] such as the construction of the verbs, verb phrases The semantic characteristics are ... shows an intention or a plan In Vietnamese, the two verbs are interpreted as “ñ ngh ” and “ñ xu t” respectively Both these two cases share the same meaning the speaker asks to carry out an action...
  • 13
  • 1,330
  • 5
A study of semantic and syntactic features of english famous love sayings and their vietnamese translation

A study of semantic and syntactic features of english famous love sayings and their vietnamese translation

Khoa học xã hội

... below Authentic Data I have had a survey at a foreign language class at Quang nam university In which, the learners are asked to translate some EFLSs into Vietnamese The result shows that the learners ... beliefs, arts, morals, law, custom, and any other capabilities, and habits acquired by man as a member of a society” ♦ Relation of Culture and Language The relationship between language and culture are ... while gain is an increase in amount [12] In translation theory, if the text describes a situation which has elements peculiar to the topics related to their language area, there is an inevitable...
  • 26
  • 1,159
  • 3
Tài liệu an analySiS of euro area Sovereign CDS anD their relation With government bonds docx

Tài liệu an analySiS of euro area Sovereign CDS anD their relation With government bonds docx

Ngân hàng - Tín dụng

... chart summarise the explanatory variables and the corresponding signs that we expect for the respective estimates of the parameters The effects of the factors are evaluated by means of a standard ... replacing iTraxx and risk aversion by the VIX leads to more or less unchanged estimates compared to the base-case model Among the three additional variables, the EONIA rate and the idiosyncratic ... Paper Series No 1271 December 2010 2.5 Factor analysis of the sample We apply factor analysis to evaluate the extent of common variation across CDS, bond spreads and the basis Table 4a shows the...
  • 49
  • 1,460
  • 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Báo cáo khoa học

... yef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAA ATGAAAACTGATAGATTACTG AGAAAGCTGGGTGGATTGCAAAATGAGCCTGAC ACAAGTTTGTACAAAAAAGCAGGCT ACCACTTTGTACAAGAAAGCTGGGT CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC ... TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAGTAAAGTTCGTTTGCCGATACATG CGTTATGAAAATCACTATTATCCCC AAAAGCTTAGATTGCAAAATGAGCCTGACGA ... ATGCGTACGCTGCAGGTCGAC GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG...
  • 13
  • 560
  • 0
Tài liệu Báo cáo khoa học: Localization of N-linked carbohydrate chains in glycoprotein ZPA of the bovine egg zona pellucida pptx

Tài liệu Báo cáo khoa học: Localization of N-linked carbohydrate chains in glycoprotein ZPA of the bovine egg zona pellucida pptx

Báo cáo khoa học

... of the acidic fraction was the same as that of the monosialylated chain, and all the acidic chains in this fraction were neutralized by sialidase digestion From the peak area, the molar ratios ... fraction in Table must be neutralized by endo-b-Galactosidase digestion, as their sialic acids are originally linked to the N-acetyllactosamine repeats While all the chains in the neutral fraction ... at 375 nm The pyridylaminated acidic fractions were also analyzed using both columns after digestion with Arthrobacter ureafaciens sialidase (Nacalai tesque, Kyoto, Japan) in 0.1 M ammonium acetate...
  • 10
  • 514
  • 0
Tài liệu An International Comparison of Milk Supply Control Programs and Their Impacts pot

Tài liệu An International Comparison of Milk Supply Control Programs and Their Impacts pot

Cao đẳng - Đại học

... This means that the remaining farms are more than making up for the production lost by outgoing farms The compound average growth rate (CAGR) in the EU, Canada, and New Zealand are almost exactly ... Zealand have both significantly increased their share of the world market, while the EU and Canadian shares have been declining Australia’s share has also declined, but that has been partially ... to change in a regular season pattern, instead of looking at their deviation from average, it may be more appropriate to look at how they compare to the same month in the previous year The table...
  • 83
  • 436
  • 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx

Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx

Báo cáo khoa học

... Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown ... Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular component in horseshoe crab hemocytes, is an antimicrobial ... to DNA sequence analysis [62] Rapid amplification of cDNA ends (RACE) Analysis by 5¢- and 3¢-RACE was performed using a SMARTTM RACE cDNA amplification kit (Clontech Laboratories, Palo Alto, CA,...
  • 13
  • 582
  • 0
Báo cáo khoa học: Identification of microsomal rat liver carboxylesterases and their activity with retinyl palmitate potx

Báo cáo khoa học: Identification of microsomal rat liver carboxylesterases and their activity with retinyl palmitate potx

Báo cáo khoa học

... TCGGCAGCACTACATTGTCAAC-3¢; ES3 5¢- GAGTCTCCGTGCAAATCCAGCG-3¢; D50580 5¢-TGTTCTTCAGAACAGCCCGCATG-3¢; AB010635 5¢-CAGCGGGAATCATCTTGAAGACC-3¢ and for AY034877 5¢-AGGCCCAGGAACACAGGGATTCC-3¢ The specificity ... for activity and the activity bands for corresponding peaks are labeled with arrows In this gel, peak appeared as a doublet (band a and b) Each peak was further separated on nondenaturing PAGE and ... male Sprague–Dawley rats The glycosylated and nonglycosylated carboxylesterases were separated during concanavalin A affinity chromatography Peaks 1–5 on preparative PAGE represent five glycosylated...
  • 12
  • 439
  • 0
Polymer assisted synthesis of aligned amorphous silicon nanowires and their core shell structures with au nanoparticles

Polymer assisted synthesis of aligned amorphous silicon nanowires and their core shell structures with au nanoparticles

Vật lý

... potential of the Au3+/Au0 couple, Au3+ has high polarization and high chemical reactivity Au3+ could be easily reduced to Au0 in air at 200 °C [19] Thus, the Au–SiNWs can be obtained by heat-treatment ... is easily obtained to be about 500 lm Thus, the growth rate of the NWs is estimated to be about 70 nm/s The magnified SEM image in the right inset shows that the NWs appear dense and parallel to ... C and O, and further quantitative analysis shows that the atomic ratio for Si:C:O is ca 1.7:7.3:1, indicating that these particles are mainly composed carbon, which can provide evidence for the...
  • 5
  • 467
  • 0
facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

Vật lý

... At a shorter reaction time of only min, there are almost no nanorods formed, and the average diameter of the nanoparticles is about nm As the reaction time increased to 10 min, part of the nanoparticles ... °C and 40% relative humidity (RH) An appropriate amount of ethanol vapor was injected into the closed chamber by a microinjector, and the sensor was exposed to air again by opening the chamber ... Thermogravimetry-differential thermal analysis (TG-DTA) of the as-prepared R-FeOOH precursor was conducted on a ZRY2P thermal analyzer Ten milligrams of an R-FeOOH sample was heated from room temperature to 600 °C in air...
  • 5
  • 458
  • 1
BENEFITS OF E-CRM FOR BANKS AND THEIR CUSTOMERS pdf

BENEFITS OF E-CRM FOR BANKS AND THEIR CUSTOMERS pdf

Ngân hàng - Tín dụng

... investigation should have general analytical strategy in order to determine what to analyse and why And the researcher’s further claim that before the data is actually analysed, investigator can choose ... reasons of this study’s approach Qualitative and Quantitative The research approach can be either qualitative or quantitative The main characteristic of quantitative research is selectivity and ... delivery We try to make most of the data already available with us This data has to be managed in better way to build relationships with the customers and to continue relationship for a longtime We...
  • 73
  • 710
  • 0
Báo cáo khoa học: Identification of rice TUBBY-like genes and their evolution Qingpo Liu docx

Báo cáo khoa học: Identification of rice TUBBY-like genes and their evolution Qingpo Liu docx

Báo cáo khoa học

... protein name: Aa, Aedes aegypti; Ag, Anopheles gambiae; Am, Apis mellifera; At, Arabidopsis thaliana; Bt, Bos taurus; Ca, Cicer arietinum; Cb, Caenorhabditis briggsae; Ce, Caenorhabditis elegans; ... seeded to search the local and Oryza sativa protein database in NCBI with an e-value of 10 Moreover, a psi-blast search against the nonredundant GenBank database was performed to collect tubby domain-containing ... evolutionary rate may take place at certain amino acid sites [18] between plant and animal tubby domains In order to identify these variant amino acid sites, the posterior probability of divergence was...
  • 9
  • 381
  • 0

Xem thêm