a unique single centre experience at the scientific research pediatric centre in the russian federation
Shaking a box of sand II – at the jamming limit, when shape matters
... discussed above This was explored via rattlers (sites i such that the local field h i = 0) in the blocked configurations generated after each tap We have seen above that they have a rather crucial role ... model The basis of the dynamics in this model is strictly local, as in real life Each grain feels a local field from all the grains above it (we have in mind that the topmost grains are the freest ... respectively to annealed and quenched theoretical values corresponding to Edwards’ flatness The vertical lines indicate the approximate values for ρ0 (left line) and ρ∞ (right line) the fraction of rattlers...
- 11
- 392
- 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... Here, the magic of apparently watching all of film history in four minutes works also as a sort of narrative black box, wherein ordinary expectations that spectators follow a rational cinematic ... this and the other Workman montages ultimately elude any causally or narratively-based rhetorical analysis as persuasive marketing devices, their very anticausality within a broadly thematic framework ... “MediaSpace” of advocacy marketing (the hallowed hall of the Academy Awards telecast venue itself) with a naturalization of cinema as performance a move moreover appropriate to marketing a commodity...
- 10
- 612
- 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc
... fits the data It indicates the amount of the relationship between the variables that remains unexplained by a model; the larger the value, the poorer the model fits the data As a rule of thumb, a ... cavities and unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three-latent ... negative Of 115 patients with a positive culture, 40 had a negative direct sputum examination Cavities were present in 34 and apical infiltrations in 73 patients There were no missing data on any...
- 7
- 506
- 0
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot
... Schematic drawing of the human Hp a- chain and the molecular arrangement of Hp phenotypes (A) The human Hp a1 -chain includes two avaiable )SH groups That at the C-terminus always links to a b-chain ... 5¢-CGGAAAACCATCGCTAACAACTAAGCTT GGG-3¢ The PCR cycling profile was as follows: denaturation at 94 °C for min, then 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension ... Using an a- chain mAb as a probe and denaturing ⁄ renaturing experiments, we further demonstrated that steric hindrance of the Hp a- chain plays a major role in determining the polymeric formation...
- 13
- 527
- 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... between the N-terminal and C-terminal Vps4p domains Our finding that the interaction of Bro1p with Vps4p is regulated by ATP binding alone is intriguing Ubiquitinated cargo proteins are sorted and then ... was not clear how many of these putative Vps4p interactions with the MVB sorting machinery may be regulated by Vps4p ATPase activity That not all Vps4p interactions are regulated by ATPase activity...
- 14
- 362
- 0
Báo cáo y học: "Deactivation of endothelium and reduction in angiogenesis in psoriatic skin and synovium by low dose infliximab therapy in combination with stable methotrexate therapy: a prospective single-centre study" ppt
... and clinical data of study patients at baseline Data Age (years) 49 (26–70) Male:female ratio 6:5 Duration of joint disease (years) (1–22) Duration of skin disease (years) 21 (2–41) Disease Activity ... in psoriasis Inflamm Res 2002, 51:563-567 Hirata S, Matsubara T, Saura R, Tateishi H, Hirohata K: Inhibition of in vitro vascular endothelial cell proliferation and in vivo neovascularization by ... infliximab therapy Reduced vascularity In both lesional dermis and synovial tissue, vascularity was significantly diminished after infliximab therapy, as shown by examination of haematoxylin stained...
- 9
- 374
- 0
Báo cáo y học: "A discrete Single Delay Model for the Intra-Venous Glucose Tolerance Test" pptx
... modelling, statistical analysis, drafting of the manuscript; PP: mathematical modeling; 18 ADG: mathematical modeling, drafting of the manuscript; 19 All authors read and approved the final manuscript ... Denoting with G and I respectively the state variable Glucose and the state variable Insulin, the variance-covariance matrix R in the present application has the structure of a blockdiagonal matrix: ... importance, the glucose/insulin system has been the object of repeated mathematical modeling attempts [1223,23-30] The mere fact that several models have been proposed shows that mathematical, statistical...
- 16
- 371
- 0
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná
... [17] has found a difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered 5,5% of the annual average ... calculated from the Equation The annual financial returns were summed until the result was the amount of capital invested in the project n ∑ RFATi (2) i where i is the year; RFAT the annual financial ... orientation are optimum, which means that the inclination is equal to the latitude of Curitiba and the orientation is to the geographic north [14] Inclination: -25,43˚ [15]; • From the database SWERA (Solar...
- 12
- 431
- 0
Putting the customer experience at the heart of your company
... having to repeat information Our Salesforce Journey week implementation Customer Warranty Registration Integration Ecommerce Direct Order Integration Marketing Cloud Integrated Live Agent Chat ... presentation may contain forward-looking statements that involve risks, uncertainties, and assumptions If any such uncertainties materialise or if any of the assumptions proves incorrect, the results ... with the highest ratings or other designation Gartner research publications consist of the opinions of Gartner's research organization and should not be construed as statements of fact Gartner...
- 24
- 476
- 0
Establishing a New Research University: The Higher School of Economics, the Russian Federation docx
... systematic use and in- depth analysis of such data The transformation of HSE into a research- intensive university required a particular organizational structure The separation between teaching (training) ... a unique advantage of operating in Russia that was truly a “laboratory of a transitional economy.” Western researchers had no easy access to such a laboratory Therefore, HSE’s specialists dealing ... identity and image also included internationalization, innovations, and a predominant orientation toward elite and emerging markets Another important factor affecting many of HSE’s decisions was its...
- 29
- 287
- 0
Financing energy efficiency and climate change migration a guide for investors in belarus, bulgaria, kazakhstan, the russian federation, and ukraine new york geneva, 2005
... application for registration Annually preparation of balance sheets and financial documentary Regisiration at the National Saitc Institute, the National Insurance Institute, the tx and ttsi a ... Enterprises Act The privatization pattern applied in Bulgaria included two programmes - Mass Privatization and Cash Privatization The Mass Privatization prograrnme consisted of distributing vouchers among ... Asia bordering the Caspian Sea, Russia, Turkmenistan, Uzbekistan, Kyrgyzstan, and China Its major cities include its capital since 1998 Astana, as well as Almaty, Karaganda, and Shymkent Kazakh...
- 253
- 603
- 0
Báo cáo khoa học: "Prevalence and demographics of anxiety disorders: a snapshot from a community health centre in Pakistan" ppsx
... observation is made only at a particular duration in time; therefore we cannot conclude that the observations are a constant factor in the studied population or a finding at only one point in time ... a significant "backbreaking" burden on the already dilapidated health service structure The study has certain limitations The results are based only on data from a single, private tertiary care ... Marital Status Married Unmarried Education Illiterate Matric (10 years of education) Intermediate (12 years of education) Graduate/postgraduate Current employment status Employed Unemployed Family...
- 6
- 486
- 0
Chernobyl’s Legacy: Health, Environmental and Socio-Economic Impacts and Recommendations to the Governments of Belarus, the Russian Federation and Ukraine pdf
... worked at the Chernobyl power plant and in the exclusion zone after the accident; — Inhabitants evacuated from contaminated areas; and — Inhabitants of contaminated areas who were not evacuated ... of Ionizing Radiation Interaction of ionizing radiation (alpha, beta, gamma and other kinds of radiation) with living matter may damage human cells, causing death to some and modifying others Exposure ... years for men) The main causes of death in the Chernobyl-affected region are the same as those nationwide — cardiovascular diseases, injuries and poisonings — rather than any radiation-related...
- 55
- 595
- 0
báo cáo khoa học: " Bioethical differences between drug addiction treatment professionals inside and outside the Russian Federation Vladimir D Mendelevich" pdf
... countries: Australia, Belgium, Brazil, Great Britain, Vietnam, Germany, Israel, Italy, Canada, China, Latvia, Macedonia, the Netherlands, the United States, Thailand, France, Croatia, and Montenegro All ... is also interesting to correlate attitudes toward euthanasia with attitudes toward specifically narcology-related bioethical problems In the Russian sample, attitudes toward euthanasia had the ... practice has to with the fact that in the Russian Federation patients with alcohol or drug dependency, in the course of receiving medical narcological care, either are not given all the information...
- 7
- 230
- 0
Báo cáo y học: "Factors affecting the outcome of surgically treated non-iatrogenic traumatic cervical esophageal perforation: 28 years experience at a single center" docx
... revised and submitted manuscript RU participated in its design and coordination KMC performed the statistical analysis and coordination AA participated in its design and coordination CO participated ... this article as: Onat et al., Factors affecting the outcome of surgically treated non-iatrogenic traumatic cervical esophageal perforation: 28 years experience at a single center Journal of Cardiothoracic ... lower than in those treated with drainage alone (10.5 and 37.5%, respectively) The patients who died after drainage alone were treated in the early 1990 s The interval from perforation to initiation...
- 5
- 389
- 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... are the experimentally determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same ... the concentration increased, indicating the absence of protein denaturation (data not shown) Whereas a linear dependence was inferred between the intrinsic fluorescence intensity of PsbQ and the ... not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated...
- 12
- 550
- 0
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt
... 71–75 Havukainen H, Haataja S, Kauko A, Pulliainen AT, Salminen A, Haikarainen T, Finne J & Papageorgiou AC (2008) Structural basis of the zinc- and terbiummediated inhibition of ferroxidase activity ... primers DpsA-Te1 (5¢-GGAGTATCGTCATATGACGACCAGTGCATTG-3¢) and DpsA-Te2 (5¢-CAGACGACACAAAGCTTCACC TTG-3¢) The NdeI and HindIII restriction sites are underlined The amplified fragment (530 bp) was digested ... The unusual Thermosynechoccus elongatus DpsA F Alaleona et al UV and gamma irradiation, and acid and base shock [3] Furthermore, it was established that the DNAbinding capacity is shared...
- 15
- 293
- 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
... electron-withdrawing groups give a line with slope q = 0.70 For all three enzymatic reactions (GGT-catalyzed transpeptidation, and AGA-catalyzed and PGA-catalyzed hydrolysis), acylation is the ratelimiting ... b-N-acetylglucosaminyl-l-asparagine has a similar function in the AGA-catalyzed hydrolysis [3] Probably, such additional stabilization by a protonated amino group in the proximity of the oxyanion can be found in the ... account Several functional groups in the vicinity of the catalytic center are assigned functions in catalysis The a- amino group of SerB1 and the main chain NH of GlnB23 activate and stabilize the c-hydroxyl...
- 10
- 425
- 0
Báo cáo hóa học: "Splenic injuries at Bugando Medical Centre in northwestern Tanzania: a tertiary hospital experience" pdf
... including Tanzania, injuries in general and splenic injury in particular are increasing due to increase in urbanization, motorization, civil violence, wars and criminal activities [5] In Bugando ... for a catchment population of approximately 13 million people from Mwanza, Mara, Kagera, Shinyanga, Tabora and Kigoma Patients and methods The subjects of this study included all patients that ... splenic trauma in Ayub teaching hospital, Abbottabad J Ayub Med Coll Abbottabad 2007, 19(3):3-5 Muhammad G, Ahmad S: Splenectomy indications hazards and alternatives J Ayub Med Coll Abbottabad 1988,...
- 9
- 278
- 0
Báo cáo khoa học: "A single centre experience with sequential and concomitant chemoradiotherapy in locally advanced stage IV tonsillar cancer" doc
... normal saline during an overnight inpatient stay Carboplatin (area under curve 4) was substituted for cisplatin if creatinine clearance was
- 10
- 359
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25