a trust based project without the bells and whistles
Báo cáo y học: "Using the intervention mapping protocol to develop a community-based intervention for the prevention of childhood obesity in a multi-centre European project: the IDEFICS intervention" pptx
... cultural and local adaptation In the months after the central training, all intervention centres planned the adoption of the intervention by the local stakeholders Plans for cultural and local adaptations ... where an existing platform was already available The establishment of the community platform and the school working groups enabled adaptation to the local culture and circumstances and ensured the ... developing a general and standardized intervention framework However, local and cultural adaptation was necessary to make the intervention feasible and to enhance deliverability in all participating...
- 15
- 341
- 0
Báo cáo sinh học: "A microsatellite-based analysis for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) populations" doc
... demographic and mutational models on which they are based, as well as on uncertainty associated with the robustness of the approaches The recent increased availability of large genomic data sets and ... data analysis and wrote the manuscript TI-T did the laboratory work and contributed to the manuscript writing and data analysis HL did the laboratory work, contributed to the manuscript writing and ... data analysis JK planned and coordinated the whole study, and contributed to the manuscript writing All the authors read and approved the final manuscript Competing interests The authors declare...
- 14
- 506
- 0
a corpus-based analysis of the collocates of the word homeland in the 1990s, 2000s and 2010s = nghiên cứu đồng định vị của từ homeland qua các thập niên 1990, 2000 và 2010 trên cơ sở ngôn ngữ học khối liệu
... describe a corpus -based analysis of the collocates of the word “homeland” The data for the analysis were taken from two popular corpora which are Corpus of Contemporary American English and Time Magazine ... a much more effective weapon # Gyatso says that in his homeland people eat mainly 21 meat, potatoes and daikon because most other vegetables are rarely available He's made a concession at Lhasa ... investigated terms related to male and female pronouns, man, woman, boy and girl, gender-related profession and such role nouns as chairman, spokesperson and policewoman, and terms of address as Mr and...
- 40
- 433
- 0
A capillary-based method determining the permeability of sand layer for geothermal applications
... method can provide an important basis for analyzing the heat transfer process of BHEs in a sand -based aquifer, and also be applied for other porous materials with the grain diameter of 0.1-0.6mm Theoretical ... the CR height, K is the permeability, L is the length of the capillary tube, Pc is the macroscopic capillary pressure, φ is the porosity, µ1 and µ are the viscosity of water and air, and ρ1 and ... be applied for other porous materials with the grain diameter of 0.1-0.6 mm (ii) The filling height of sand samples and the immersion depth of the capillary tube at the initial state had a great...
- 8
- 449
- 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb , and arc the rotor fluxes induced in the stator phases are The ... same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The airgap length is constant and large since the magnets ... magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an important air part so that the effects of the saturation...
- 8
- 517
- 1
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... correlated Therefore, we can treat the friends’ recent posts in the same way as the recent posts of the author, and learn the transition matrix , where | , and apply the tech′ nique proposed in the ... was played on February 6th, 2011 The valence value is not as high as the arousal value because some fans might not be very happy to see their favorite team losing the game (2) The query, volcano, ... counting and Sun et al 2010 Chinese dictionaries Davidov et al n-grams, word patterns, 2010 punctuation information Bermingham and n-grams and POS tags Smeaton 2010 SVM upper cases Naive Bayes,...
- 6
- 449
- 0
A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc
... Klein Namaqualand, and Gordonia, Cape Colony, and what was at that time known as German South- West Africa Four of them appeared a few years back in The State an illustrated magazine now unhappily ... lethargy had I been dreaming? No there it was again; and now across the pan came streaming back the herd of gemsbok, and after them ran and stumbled a nude black figure, that now and again paused ... dunes, there may be t'samma there, and the way across is easy Come!" He led the way down the steep slope, dragging his jaded animals after him At the edge, where sand ended and salt began, lay many...
- 160
- 619
- 1
A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot
... to Canada, Australia, Britain and Mexico, with Canada receiving 81% of the total The Monitor Company (1999) estimates that the total dollar loss to the US as a result of economic runaways was ... competitive advantages in the form of increasing returns to scale and scope and positive agglomeration economies Such advantages are fundamental in maintaining the status of the region as the leading ... in Table 4, as well as in a number of lesser markets such as Austria, Finland, Israel, Hong Kong, Singapore, Panama and Peru In yet other markets the majors engage in joint ventures and contractual...
- 19
- 703
- 0
Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf
... in analytic languages by incorporating CCG with a memory mechanism In the memory mechanism, fillers and gaps are stored as modalities that modalize a syntactic category The fillers and the gaps are ... have the same grammatical categories (such as tense, aspect, and modality), and shares at least one argument, i.e a grammatical subject As each verb is tensed, SVC is considered as coordination ... derivation, we can then replace the decomposition rule of the canonical CCG with the gap resolution process of MICG Fillers and gaps are associated in the coordination and serialization by the gap-resolution...
- 9
- 572
- 0
A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc
... loosely associated with the goals of the organization and the demands of the uncertain and changing environments (March and Olsen, 1976; Weick, 1976) The third view, based on the rational adaptation ... On the other hand, it is probable that resistance to change may at times have a positive effect on the outcome of organizational change, and that it may be strategically valuable to an organization ... situations in which changes are undertaken are shifting, it is harder for organizations, and in particular top managers as well as change agents, to prepare for and manage the change in ways that...
- 249
- 378
- 0
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt
... endings and enelities This grammar can both generate from a given lemma all the current Italian words deriving from it and analyze a given word by 33 lemma I stem matte mattino di andare andare matt ... U.Bortolini, C.Tagliavini and A. Zampolli, Lessico di freq.enza delia lingua italiana contemporanea, ed IBM, 1971 161 B.Bottini and M.Cappelli, Un Meta Analizzatore Orienial al Linguaggio Natnrale in Ambiente ... structured as tables of a relational data base l the morphologic and semantic characteristics of the word, but not its syntactic cathegory: for example, the easa (house) can be altered in casina (little...
- 6
- 378
- 0
A Risk-based Audit of the Captive/Privately- owned Cervid Industry in Michigan pot
... welfare of domestic animals in the Animal Industry Act (AIA), P .A 466 of 1988 (AIA 1988) The AIA was “intended to protect the health, safety, and welfare of humans and animals” and consequently addresses ... Prioritizing Facility Inspection 151 xi List of abbreviations AB Alberta, Canada AHDL Animal Health Diagnostic Laboratory AIA Animal Industry Act AID Animal Industry Division, Michigan Department of Agriculture ... coordinates (longitude and latitude values) to the State standard map projection (Michigan GeoReference projection), and overlaid with base data and either 1998 or 1992 aerial photography (digital...
- 168
- 282
- 1
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... transferase Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase IGb3 synthetase IGb3 synthetase Forssman synthetasea Forssman synthetase Human Rat Pig Mouse Human ... the urinary bladder, the uterus and the thymus A weaker signal was obtained from the pancreas and very weak, barely detectable, signals were visible from a salivary gland, muscle and spleen The ... room temperature Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification was performed...
- 8
- 499
- 0
highly efficient human action recognition using compact 2dpca-based descriptors in the spatial and transform domains
... D Zhang, A F Frangi and J Y Yang “Two-dimensional PCA: A new approach to appearance -based face representation and recognition”, IEEE Tran on PAMI, vol.26, no.1, pp.131-137, Jan 2004 M A Naiel, ... M Abdelwahab, W B Mikhael ”Human action recognition employing 2DPCA and VQ in the spatio-temporal domain”, IEEE NEWCAS, Montreal, Canada, pp.381-384, Jun 2010 http://pascal.inrialpes.fr/data/human/, ... gallop sideways, bend, wave one hand, wave two hands, jump in place, jump-jack, and skip, as Table I shows that we are maintaining the excellent recognition accuracy compared with other recently...
- 4
- 237
- 1
báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx
... training programs in medical management These related to the delivery of health care, financial management, organizational management, and legal and ethical considerations [7] In a survey of American ... individuals with management potential as part of a broader career management and succession planning initiative The fact that public sector managers have rated themselves as at least "reasonably ... (p 0.001) The Cronbach's alpha and the mean total scores for the management competency subscales are presented in Table below The Cronbach's alphas for all the scales are at an acceptable level...
- 7
- 503
- 0
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx
... set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design of the study and performed the statistical ... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant into the ... this standard approach, lateral parts of the annulus and even lateral aspects of the nucleus potentially remain in situ, as can be suspected by unaffected clinical re-herniation rates after nucleotomy...
- 9
- 457
- 0
Web-Based Learning Environment: A Theory-Based Design Process for Development and Evaluation pdf
... schematics of main pages, displaying rough navigation and the layout of elements that need to appear on a page The main objective of the process was to specify the content layout and navigational ... Accuracy was based on the occurrence of acceptable ideas in the participant’s responses To compute a score for a participant, initial knowledge and recall were measured by the participant’s ability ... & Carey’s (1996) evaluation approach may be the best candidate, because this approach allows different types of evaluators (e.g., experts, individual, and group of evaluators) to evaluate various...
- 21
- 383
- 0
A factor analysis study on the skills and values covered in the social studies course
... Factor analysis was done as well Factor analysis is a multivariable statistical analysis method used to present data in an understandable summarized way based on the relationships between data ... that the four factors, which appeared as significant in the analysis, together explain the majority of the total variance in the items, and the variance related to the scale The number of the ... katJlmJQtJr Bu araQtJrmada veri toplama aracJ olarak, araQtJrmacJlar tarafJndan hazJrlanan ölçek ve gözlem anketleri kullanJlmJQtJr Bulgular: Ö retmenler tarafJndan gözlenen ö rencilerin davranJQlarJyla...
- 11
- 509
- 0
Báo cáo toán học: "A duality based proof of the Combinatorial Nullstellensatz Omran Kouba" pps
... [T ])∗ and, consequently, it has a unique expression as a linear combination of the elements of the basis (µt )t∈S This proves the existence of a familly of scalars (λS )t∈S , such that t S ... for any polynomial P in Km [T ], and achieves the proof of Lemma Before proceeding with the proof of Theorem 1, let us recall that the total degree of a polynomial P from K[X1 , , Xm ] is the ... ends the proof of Theorem References [1] Alon, N., Combinatorial Nullstellensatz Recent trends in combinatorics (M´traa h´za, 1995) Combin Probab Comput (1999), 7–29 a [2] Shirazi, H and Verstra¨te,...
- 3
- 266
- 0
Báo cáo toán học: "On a class of hyperplanes of the symplectic and Hermitian dual polar spaces" doc
... Lemmas 4.2 and 4.3, Ax ⊆ H and hence Ax = H since Ax is a maximal subspace Proposition 4.5 The q+1 hyperplanes containing Hπ as a hyperplane are all isomorphic Proof Suppose the radical of π has ... is a Hermitian polarity, we assume that there exists a totally isotropic subspace of maximal dimension n − Notice that such a subspace always exists in the symplectic case In the case ζ is a Hermitian ... which contain Hπ as a hyperplane and that all these hyperplanes are isomorphic Some other properties of these hyperplanes are investigated 2.1 The symplectic case Definition and properties of the hyperplanes...
- 20
- 281
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008