a touch of dead sookie stackhouse the complete short stories
Shaking a box of sand II – at the jamming limit, when shape matters
... configu-rational landscapes and surface intermittency.We have in the above focused largely on the fast dynamical behaviour of the top of a column of grains in the jamming limit, alluding to an increasingly ... the way in which we envisaged a as the aspect ratio of a rectangular grain there, can take any value, rational or irrational, in this chapter.It can, in this chapter, equally represent the ... out that they are also a goodprobe of Edwards’ flatness under the tapping dynamics of the random graphs model[152, 153].If blocked states at a given density are equiprobable, theoretical arguments...
- 11
- 392
- 0
Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf
... structures and vocabulary used in an essay. 6. The essay will also be judged on the use of language. Naturally the readers will notice grammatical errors and the number of errors in a paper. They ... reasons will form the body of the essay: - they can learn about responsibility, - they can learn the value of money, - they can learn how to work as a member of a team. B. Body of the ... one of these three areas and describe the most important qualities of a leader in that area. Explain why these qualities are important, using specific examples and details. (A) Point of View...
- 23
- 784
- 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... Theories of monogenism and polygenism. Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth. Eurafrica, Austafrica, ... Spoken Language.—Articulate and inarticulate speech. Imitative sounds. The phonology of languages. Universal alphabets. Logical relations of the parts of speech. The vocabulary and the grammar of ... Austafrica, Asia, America, Oceanica. Causes and consequences of the migrations of races and nations. a. The Eurafrican Race.—Types of the white race. Its first home. Early migrations. The South...
- 28
- 665
- 0
Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt
... were treated as described in (A) . Total RNA wasprepared at the indicated times and subjected to quantitative real-time PCR analysis. The data shown are mean value ± standard errors of the mean from ... epididymal fat pads harvested from ob ⁄ obmice and genetically matched lean mice. Levels of miRNA expres-sion were analyzed by TaqMan quantitative PCR. Data are meanvalue ± standard errors of the ... (Santa Cruz Biotechnology, Santa Cruz, CA,USA), and anti-PPARa (Zymed Laboratories, South SanFrancisco, CA, USA), and mouse monoclonal anti-b-actin(Sigma Aldrich, St Louis, MO, USA).Quantitative...
- 11
- 848
- 0
Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx
... oz.water) and paint the drywall with the mixture. You can also hair spray or sprayvarnish to seal the drywall as well. The top of a piece of drywall is the side that tapers down at the edges, ... useablematerial.painting a picture created with paintkiln A baking oven for clay or metal.lost wax A method of creating a wax mold of a sculpture and then heating the mold to melt out the wax ... water will harden into a chalk-like solid.proportion In any composition. the mathematical relationship of the parts toeach other and to the whole. For example, the relation of the headto the...
- 6
- 681
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... betweenard1 and ard2 are part of the ata cluster, ata12 and ataPKS1should also pertain to it. Further sequencing of the atacluster could provide an insight into the biosyntheticpathway of the other ... comprise a large region of a putative A2 0 1A biosynthetic (ata) gene cluster. The sequence of the 7 kbupstream of ard1 towards ard2 reveals seven consecutiveopen reading frames: ataP3, ataP5, ataP4, ... orientation(Figs2and 3A) .Ofthese,five(ataP3, ataP5, ataP4, ataP10and ataP7) are highly similar to known or putative genesthat are known or proposed to be implicated in the biosynthesis of the aminonucleoside...
- 9
- 728
- 0
Tài liệu The 28th: A Record of War Service in the Australian Imperial Force, 1915-19 docx
... around the fortifications near Helles and the villages of Krithia, Kurija Dere, Biyuk Anafarta, and Anafarta Sagir. On the side nearer Asia, Maidos,Galata, and Gallipoli boasted the status of ... and the Pyramid, I haveespecially to thank Captain E. A. E. Andrewartha of the Australian Staff Corps. The publication of the Nominal Rolls of Members of the Battalion has been made possible largely ... cent. of the officers and other ranks were Australianborn. The other moiety was composed almost wholly of natives of the British Isles. A Russian, a Maltese, a Scandinavian or two, and a few others,...
- 134
- 412
- 0
A History of English Romanticism in the Nineteenth Century pdf
... ff.APPENDIX B." ;The magical touch and the sense of mystery and all the things that are associated with the name romance,when that name is applied to &apos ;The Ancient Mariner,' or 'La ... sympathy which he wasalways fond of imagining between the soul of man and the things of nature.[20]Or take again the "Song at the Feast of Brougham Castle," an incident in the Wars of ... the ItalianMiddle Age he anticipated the Pre-Raphaelites and the modern interpreters of Dante. Here is a part of what hesays of the paintings in the Campo Santo at Pisa: " ;The best idea, perhaps,...
- 169
- 602
- 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... CGCTGCAGTAAGAGCAGTAAACCCGVps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATTVps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAGVps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATCYEE ... F CTGGACACAGCCACGCAGTATACAGCATACTATAACGGYEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAGIRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGGTable 3. Plasmids ... Vta1p and Vps46p regulate the membraneassociation and ATPase activity of Vps4p at the yeastmultivesicular body. Proc Natl Acad Sci USA 103,6202–6207.41 Amerik AY, Nowak J, Swaminathan S &...
- 14
- 362
- 0
A Course of Lectures DELIVERED BEFORE THE UNIVERSITY OF CAMBRIDGE pptx
... greater difference between an Afghan, a Sikh, a Hindustani, a Bengalese, and a Dravidian than between an Englishman, a Frenchman, a German, and a Russian—yet all are classed as Hindus, and all ... grammatical elements also, can be studied to greater advantage than among the Aryan, the Dravidian, and the Munda inhabitants of India, when brought in contact with their various invaders and ... what applies to the Rig-Veda applies to many other books. But even if Sanskrit were more of a dead language than it really is, all the living languages of India, both Aryan and Dravidian, draw...
- 265
- 315
- 0
The Internet of Things: A critique of ambient technology and the all-seeing network of RFID potx
... perhaps among the artisans that one should go to find the most admirable proofs of the sagacity, the patience, and the resources of the intellect. I admit that the greater part of the arts has been ... link through the disappearance of the image in the icon; in network through the disappearance of cable in mobile and satellite - towards the disappearance of the digital as tangible and visible ... what they had actually seen. They had witnessed a powerful manifestation of the existence of an another ‘society’ that had no institutional place in the political organisation of their time. The...
- 62
- 649
- 0
Báo cáo khoa học: A family of killer toxins Exploring the mechanism of ADP-ribosylating toxins pptx
... M,Murata T, Nakayama K, Asakawa K, Ohara M,Komatsuzawa H & Sugai M (2001) Complete nucleotidesequence of a Staphylococcus aureus exfoliative toxin Bplasmid and identification of a novel ADP-ribosyltrans-ferase, ... are a large family of dangerous andpotentially lethal toxins. Examples of these toxins canbe found in a diverse range of bacterial pathogens andthey are the principal causative agents in many ... by the findings that actin, EF2, Gai,Gasand the Rho GTPasesall have target residues that are analogous to diphtha-mide and a nearby aspartate ⁄ glutamate residue sim-ilar to one of the...
- 15
- 333
- 0
Báo cáo khoa học: "A Figure of Merit Technique for the Resolution of Non-Grammatical Ambiguity" ppt
... resolution of non-grammatical ambiguity re- quires some kind of contextual analysis; and, in the case of mechanical translation, the contextual analysis should be such that it can be readily performed ... wholly, inappropriate. In most of these cases, the incorrectness was attributable to the fact that the source of the data on word occurrences was limited in size, and also biassed rather heavily ... multiple meaning words, as well as the "free" translations in which the ambiguity had been resolved by a human translator. Since the aim was to eliminate * Each text was a part of an article...
- 5
- 298
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008