a tool to study human pathogens
Developing a 3d multi body simulation tool to study dynamic behaviour of human scoliosis
... (ordinary differential equations (OED)) less number of variables and parameters (as compared to Lagrange method), and availability of many efficient algorithms to calculate the partial derivatives ... et al 1996, Kumaresan, Yoganandan et al 1999, Teo and Ng 2001, Natarajan, Williams et al 2007, Greaves, Gadala et al 2008) Although this type of models can predict internal stresses, strains and ... 2005)(Pamela K Levangie 2005)(Pamela K Levangie 2005)(Pamela K Levangie 2005)(Pamela K Levangie 2005)(Pamela K Levangie 2005)(Pamela K Levangie 2005)(Pamela K Levangie 2005)(Pamela K Levangie 2005)(Pamela...
- 167
- 566
- 0
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx
... present study The mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures for survivors and nonsurvivors APACHE II ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated ... require more information Calculating HGI should be feasible in ICUs that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses...
- 6
- 264
- 0
Báo cáo y học: "So much to teach, so little time: a prospective cohort study evaluating a tool to select content for a critical care curriculum" potx
... the study, participated in data collection and statistical analysis, and drafted the manuscript KM helped to develop the study design, participated in statistical analysis and helped to draft ... the procedure was repeated by adding them together to create a separate composite score that could range from to For each of the clinical presentations, we calculated a mean value for the two ... identified residents and critical care medicine attending physicians as our key stakeholders For each of the presentations we asked participants to assign a numerical value from to based on the descriptions...
- 6
- 209
- 0
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 1 pdf
... Shilpa Ramdas Mahangade, Gaurav Wason, and Maliha Zaman who helped in administrating the entire process Finally, we thank our families, Sharmini, Vinesh, Dharman and Michael, Jessica, and Christa, ... Participants and Factors Respondent Organizational Position Administror Administrator Administror Administrator Professional Professional Lower-level Manager Lower-level Manager Administrator Administror ... Lower-level Manager 16 Lower-level Manager Administrator 17 Administror 18 Top-level Manager Top-level Manager 19 Administror Administrator Administrator 20 Administror Lower-level Manager 21 Lower-level...
- 59
- 588
- 0
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 2 doc
... workplace: A behaviorbased artificial intelligence approach Journal of Management Information Systems, 19(1), 243-266 Anandarajan, M., Simmers, C .A. , & Igbaria, M (2000) An exploratory investigation ... recreation has already served many supportive purposes in organizations; games can be used to help decrease computer anxiety and encourage experimentation (Agarwal & Karahanna, 2000; Oravec, ... adequately address this challenge (Anandarajan, 2002) Management must make an effort to understand the dimensions underlying personal Web usage behaviors if they are to hope to effectively manage...
- 33
- 630
- 0
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx
... exploratory factor analysis with varimax rotation was conducted on the 18 measures The factor analysis revealed four factors and explained 64.36% of the variance in the data Table shows the factor loadings ... the table The alpha values are greater than 0.6 indicating that the items in each factor belong together Table also contains labels that the author applied to the factors Deterrent and remedial ... the trustor about a particular person within a specific situation (Gabarro, 1987) Trust is also a mental state which changes as additional data are collected Every interaction is evaluated and judged...
- 46
- 562
- 0
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 4 doc
... Firewall, McAfee Firewall, and ZoneAlarm Firewall Corporate firewalls usually combine hardware and software CheckPoint Firewall, Raptor Firewall, and Gauntlet Firewall are examples of corporate ... mechanisms that an organization might use, but they are generally grouped into one of two categories: managerial and technical The managerial techniques for monitoring are similar to ways that monitoring ... tend to be device independent Next, the manager has to actually get access to the data captured by the program Finally, the manager must be able to sift through the mountains of generated data to...
- 33
- 534
- 0
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 5 pdf
... are given in Table Table Means and Standard Deviations of Dependent Variables Nigeria U.S Malaysia Web Usage a Mean Standard Deviation Mean Standard Deviation Mean Standard Deviation Competitor ... Workplace in Nigeria, Malaysia, and the United States 181 Wright, P M., Smart, D., & McMahan, G C (1995) Matches between human resources and strategy among NCAA basketball teams Academy of Management ... (2000) A constrastive analysis of negotiation styles among Malaysian Malays, Chinese and Indians: A practical guide to doing business with Malaysians 2000 Academy of Marketing Science Multicultural...
- 58
- 487
- 0
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 6 pptx
... names “playfulkitty4U” and “kinkygal,” claiming she was “into rape fantasy and gang-bang fantasy.” As a result of these postings, she started to receive obscene phone calls and visits by men to ... Los Angeles when Gary Dellapenta, a 50-year-old security guard, was arrested for his online activities It all began when Dellapenta was rebuffed by his 28-year-old victim, Randi Barber As a result ... superego was a set of moral values and selfcritical attitudes Furthermore, influenced by Darwinian metaphors of his day, Freud hypothesized that humankind was still evolving and torn by a fundamental...
- 30
- 492
- 0
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 7 doc
... Computing, Journal of Management Education, Journal of Mathematics and Science Teaching, and Annals of Cases on Information Technology Pruthikrai Mahatanankoon is an Assistant Professor of Information ... of this chapter are to investigate what factor leads to personal Internet usage, and to examine the impact of personal Internet usage on job satisfaction and work performance By understanding the ... prohibited 252 Mahatanankoon and Igbaria spend on personal activities reduces their productivity Anandarajan and Simmers (2001) suggest that accessing personal-related websites at work leads to serious...
- 31
- 594
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using...
- 12
- 616
- 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
... Netherlands A. Y Hoekstra and A. K Chapagain – July 2006 22 Water’s vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water ... case study on the Zambezi basin A. K Chapagain − February 2000 Water value flows: A case study on the Zambezi basin A. Y Hoekstra, H.H.G Savenije and A. K Chapagain − March 2000 The water value-flow ... Seyam and A. Y Hoekstra − December 2000 The value of irrigation water in Nyanyadzi smallholder irrigation scheme, Zimbabwe G.T Pazvakawambwa and P van der Zaag – January 2001 The economic valuation...
- 46
- 959
- 0
Using an Alu Insertion Polymorphism to Study Human Populations docx
... Nigerian Pakistani Papua New Guinea Papua New Guinea (Coastal) Pushtoon Pygmy (Central Africa) Pygmy (Zaire, now Congo) Sardinian (Aritzo) Sardinian (Marrubiu) Sardinian (Ollolai) Sardinian (San ... create artifact bands Gels containing CarolinaBLU™ may be prepared one day ahead of the lab day, if necessary However, gels stored longer tend to fade and lose their ability to stain DNA bands ... Aborigine Breton Cajun Chinese Euro-American Filipino French German Greek, Cyprus Hispanic American Hungarian India Christian India Hindu Indian Muslim Italian Java Malay Maya Moluccas Mvsoke Nguni...
- 36
- 533
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical ... objectives and requirements of related factors, as well as the alternatives that have been used in the study area. From that it suggests the measures to solve the problems and apply the MCA approach for selecting the most suitable ...
- 13
- 487
- 0
A guide to effective human resources management
... Shilpa Ramdas Mahangade, Gaurav Wason, and Maliha Zaman who helped in administrating the entire process Finally, we thank our families, Sharmini, Vinesh, Dharman and Michael, Jessica, and Christa, ... Participants and Factors Respondent Organizational Position Administror Administrator Administror Administrator Professional Professional Lower-level Manager Lower-level Manager Administrator Administror ... Lower-level Manager 16 Lower-level Manager Administrator 17 Administror 18 Top-level Manager Top-level Manager 19 Administror Administrator Administrator 20 Administror Lower-level Manager 21 Lower-level...
- 292
- 501
- 0
the community development handbook a tool to build community capacity
... that it is familiar to us and that we have a part to play in it This handbook has been created by the Labor Market Learning and Development Unit at Human Resources Development Canada to support ... support was greatly appreciated It was presented in a way that was understood and realistic because it was based on experience with what works and what doesn't It was also validated and highly valued ... undertaken As a small group, informal communication and organizational arrangements were probably all that s s s s s d e v e l o p i n g s integrating and coordinating a variety of tasks and activities,...
- 90
- 284
- 0
báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt
... Quattrini C, Tavakoli M, Jeziorska M, Kallinikos P, Tesfaye S, Finnigan J, Marshall A, Boulton AJ, Efron N, Malik RA: Surrogate Markers of Small Fiber Damage in Human Diabetic Neuropathy Diabetes ... keratinocytes Implications for normal and impaired wound healing J Biol Chem 1995, 270:12607-12613 Saaristo A, Tammela T, Farkkila A, Karkkainen M, Suominen E, YlaHerttuala S, Alitalo K: Vascular ... display cellular characteristics of senescence J Vasc Surg 1998, 28:876-883 Hasan A, Murata H, Falabella A, Ochoa S, Zhou L, Badiavas E, Falanga V: Dermal fibroblasts from venous ulcers are unresponsive...
- 9
- 487
- 0
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... three latent factors, that appeared suitable for use as a rapid tool for quantitative assessments of motivation Qualitative data and reflection on observations made by the PI in this study during ... current work was, however, to develop a rapid tool (eventually of 10 items) that, through factor analysis, appears to capture motivation quantitatively Qualitative data suggest that the questions ... improve explanatory ability Ethical issues Ethical clearance for the broader study was obtained from Kenya's National Ethics Review Committee, and permis- Quantitative data In total, 720 SAQs were...
- 11
- 445
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008