... non-parametric alternatives were used Toevaluate the capacity to significantly discriminate the scores of the three groups, the non-parametric KruskallWallis test was applied The non-parametric ... on each question are added to obtain a total score for the test With SCTs, a theoretical score of 100 would mean that the person had answered each item in the same way that the majority of panel ... have good clinical judgment and may need to take remedial action The study has several limitations It addresses only three specific areas of radiation oncology, and participants come from a limited...
... the screens advancing automatically, although the participant may pause the tutorial at any time Following the tutorial, the participant is granted access to the AGREE II user's manual and is instructed ... the tool This algorithm has been pilot tested and refined and is currently used by the Capacity Enhancement Program of the Canadian Partnership Against Cancer (CPAC) to hire appraisers to participate ... inform KTE initiatives related to PG standards and evaluation, as well as the literature on instructional design and optimal training program design to balance learning and performance outcomes...
... date have evaluated self-audits or external audits, and most combined chart audit with formal feedback or an educational intervention [8-11] Audit-feedback generally involves external audit and ... Implementation Science 2007, 2:24 Background The Accreditation Council on Graduate Medical Education (ACGME) mandates Practice-Based Learning and Improvement as a core competency area for residents ... patients, and patient lists were reviewed manually to ascertain that no patient's chart was used more than once per audit Audit one was performed in June 2003 Residents were allowed to abstract...
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...
... Netherlands A. Y Hoekstra and A. K Chapagain – July 2006 22 Water’s vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water ... Seyam and A. Y Hoekstra − December 2000 The value of irrigation water in Nyanyadzi smallholder irrigation scheme, Zimbabwe G.T Pazvakawambwa and P van der Zaag – January 2001 The economic valuation ... business water footprint accounting can be done at any level of aggregation – provided that data on inputs are available – but that accounting at a lower level of aggregation provides data at a lower...
... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical ... own advantages and disadvantages. Table 1 summarizes some these methods and their features. In comparison with the ranking and rating methods, pairwise comparison and trade‐off ...
... that it is familiar to us and that we have a part to play in it This handbook has been created by the Labor Market Learning and Development Unit at Human Resources Development Canada to support ... support was greatly appreciated It was presented in a way that was understood and realistic because it was based on experience with what works and what doesn't It was also validated and highly valued ... undertaken As a small group, informal communication and organizational arrangements were probably all that s s s s s d e v e l o p i n g s integrating and coordinating a variety of tasks and activities,...
... current work was, however, to develop a rapid tool (eventually of 10 items) that, through factor analysis, appears to capture motivation quantitatively Qualitative data suggest that the questions ... representing three latent factors, that appeared suitable for use as a rapid tool for quantitative assessments of motivation Qualitative data and reflection on observations made by the PI in this ... developed an SAQ to assess motivation in hospital-based Kenyan health workers Additionally, a comparison of the quantitative and qualitative results was made to help understand the motivation score...
... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... experiences of relapse management, and a preliminary 154item questionnaire Eight clinically relevant areas emerged: access to care, coordination of care, physical comfort, technical aspects of care, involvement ... (the aim was to achieve a simple structure, that is, each item should be associated with one and only one factor) Data quality Missing item data < 10% High % computable scale scores Scaling assumptions...
... domains and in aggregate) to Rasch analysis The retained items–by virtue of fitting the Rasch model, like all items that fit the Rasch model–are guaranteed to have the same measurement characteristics ... Denver, Colorado, 80206, USA 2Palo Alto Medical Foundation Research Institute, Palo Alto Medical Foundation, 795 El Camino Real, Palo Alto, California, 94301, USA 3Morgridge College of Education, University ... http://www.hqlo.com/content/8/1/77 Page of separation index, similar in its interpretation to Cronbach’s coefficient alpha Table Baseline Characteristics of Subjects ATAQ-IPF scores and their associations with clinical measures...
... at references toA In the current implementation, a base variables must be a scalar, an array of scalars, a pointer toa scalar, or a pointer to an array of scalars, where a scalar is a variable ... pointer base variables are all scalar and array of scalar variables Heap locations are not analyzed; if a base variable can refer toa heap location, a report is generated the designer, who can take ... Note that pointers automatically arise in C when an array is passed as a parameter toa function: C automatically converts the array parameter toa pointer parameter This is a common situation...
... ratio 0.0 AAAB Log R ratio 0.0 AABBB AAABB ABBB AABB ABB AAAB AAA ABBB BBB ABB AAB BB AB BB AB A B -1.0 -1.0 AA AABB AA -0.5 -0.5 AAB 0.0 (a) Popova et al R128.7 0.2 0.4 0.6 0.8 1.0 B Allele frequency ... (a) 0.2 0.4 0.6 0.8 B Allele frequency 1.0 1.0 0.0 (b) BB B 0.2 0.4 0.6 0.8 B Allele frequency AA AB BB -1.0 A AAAB AABB ABBB ABB BBB AAA AAB -0.5 AB Log R ratio 0.0 0.5 1.0 AA AABB ABBB BBB AAB ... AABB ABBB BBB AAB ABB AAAB -1.0 B Log R ratio 0.0 0.5 BB -1.0 A AB AAA -0.5 -0.5 AA ABB Popova et al R128.5 of a haploid genome, possibly similar to the triploid glioblastoma cases described...
... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and ... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea...
... Implementation Science 2009, 4:46 knowledge; and to facilitate organizational change [19] Thus, an organization that supports and encourages innovation, data collection and analysis, and critical appraisal ... people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and subscriptions The Page of (page number ... distinctions that the tool makes in relation to these four areas are important to identify The tool can serve as a catalyst for an important discussion about research use; such a discussion, in and of...
... Implementation Science 2009, 4:46 knowledge; and to facilitate organizational change [19] Thus, an organization that supports and encourages innovation, data collection and analysis, and critical appraisal ... people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and subscriptions The Page of (page number ... distinctions that the tool makes in relation to these four areas are important to identify The tool can serve as a catalyst for an important discussion about research use; such a discussion, in and of...
... mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures for survivors and nonsurvivors APACHE II scores were available ... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated...
... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... rection Comparison of normalisation, standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from ... session factors can be estimated from all available data in the multi-session data set with two different approaches: calculation of a between-session ratio matrix (Ratio approach) or a maximum...
... study, participated in data collection and statistical analysis, and drafted the manuscript KM helped to develop the study design, participated in statistical analysis and helped to draft the manuscript ... the procedure was repeated by adding them together to create a separate composite score that could range from to For each of the clinical presentations, we calculated a mean value for the two ... on two scales: impact and frequency For each clinical presentation the mean scores on each scale were multiplied, resulting in a score that was used toevaluate relevance of material to their...