a the testis is expanded these are most commonly seen in men 20 40 years of age b on palpation the tumor

35859 this is and these are

Ngày tải lên : 31/08/2016, 20:52

... 5 (This is – These are) my ears ...

2
264
1

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Ngày tải lên : 18/02/2014, 12:20

... CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport b- gal plasmid) CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with ... 200 8 The Authors Journal compilation ª 200 8 FEBS S Ma et al (1) β-gal CMV Transcription start site C β-gal (2) ARS-β-gal CMV Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’...

19
596
0

Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx

Ngày tải lên : 18/06/2014, 19:20

... of apoptosis (Annexin V+, 7AAD-) and (B) late stages of apoptosis (Annexin V+, 7AAD+); (C) CD8 lymphocytes in early stages of apoptosis (Annexin V+, 7AAD-) and (D) late stages of apoptosis (Annexin ... variation by season of the year We found that shipping of blood in insulated containers by contracted overnight carriers is associated with large seasonal variations in temperature inside the packaging, ... we find that there is function in the PBMC that are viable after overnight incubation Incubation at 15 or 30°C is associated with comparable T cell function assessed by ELIspot assay to that seen...

13
606
0

Báo cáo khoa học: "Follow-up of newborns treated with extracorporeal membrane oxygenation: a nationwide evaluation at 5 years of age" pptx

Ngày tải lên : 13/08/2014, 03:20

... programme High response rates are feasible because travelling distances are short in The Netherlands and regionalised high-risk perinatal care, including ECMO, is available The children are scheduled ... jugular vein are cannulated and subsequently ligated after bypass is finished Finally, the heparin that is administered to prevent the blood from clotting might cause intracranial haemorrhage as a ... intraventricular haemorrhage grade and grade Major: intraventricular haemorrhage grade and grade Nonhaemorrhagic intracranial abnormalities (n) Minor: ventricular dilatation and focal atrophy 17 Major:...

11
368
0

Prevalence and predictors of falls and dizziness in people younger and older than 80 years of age—a longitudinal cohort study

Ngày tải lên : 25/08/2016, 22:54

... whereas diazepam (N05BA01) is the only long-acting benzodiazepine The data were dichotomized as yes, taking the medication or no, not taking the medication of falling was measured using a single-item ... falls and dizziness the signiﬁcant variables from the bivariate analyses at baseline were included as independent variables in multiple logistic regression analyses (manual backward), with data ... years 3 -years p = 0. 420 6 -years p = 0 .406 b Nagelkerke R2: under aged 80 0.138, 80+ years 3 -years 0.153 6 -years 0.167 c Variables at baseline entered into the regression analysis (manual backward):...

9
275
0

Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?

Ngày tải lên : 26/12/2014, 08:36

... that they can learn and develop further 5)wise in the handling of document • A good manager must know how in the processing data Maybe managers are afraid of cumbersome paperwork but the manager ... encouragement emanates from the Latin word Cor, meaning heart It means to give courage, confidence or hope Having courage is having the ability to disregard fear and to be brave The easiest way ... • Convey understanding, experience • Wise in the handling of documents • I)Qualities and skills of managers: • 1)management: • A manager's most important, and most difficult job is to manage...

16
1.4K
1

English is the most popular language in the world

Ngày tải lên : 09/04/2013, 08:49

... read the text and match the headings for paragraphs Paragraph A The tragic accident Paragraph B The lift- off Paragraph C Congratulations Paragraph D A view on Earth Paragraph E Uncertainties In ... singing and dancing for them D taking to the baseball games Big Brothers is A the name of the club B a home for children C the name of a film D on organization for boys who no longer have fathers ... comprehension is best described as an understanding between the author and the reader The emphasis is on the reader understanding of the printed page based on the individual reader’s unique background of...

53
1.1K
2

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Ngày tải lên : 18/02/2014, 16:20

... AAA and AAG by the arginine codons AGA and AGG respectively Rac1L61G189 was obtained by mutation of the cysteine codon TGC into the glycine codon GGC In all cases, the absence of additional mutations ... ubiquitination in the presence of Rac1L61 (Fig 3A, right panel), indicating that the stimulation of Rac1-dependent pathways may, in some way, activate the Rac1 ubiquitination machinery As Rac 1b has been ... ubiquitination that are not fulﬁlled by Rac 1b From our mutational analysis of Rac1 lysine residues, the main ubiquitin addition site in activated Rac1 appears to be Lys147; this result probably...

11
469
0

MARKETING DURING A DOWNTURN: INSIGHTS INTO HOW MARKETERS ARE HANDLING THE SLUMP pot

Ngày tải lên : 06/03/2014, 21:20

... expensive; therefore, they are a natural irst category to cut Only 7% of respondents are increasing investment in this area: 33% are not changing investment while 59% are decreasing it Print advertising ... publishing Case Studies, benchmark data, and how-to information read by hundreds of thousands of advertising, marketing and PR professionals every week Praised by The Economist, Harvard Business ... 47% are increasing spend on Web 2.0 strategies; only 8% are decreasing spend The low costs associated with these two tactics are probably one reason Lisa Mathisen, Owner, Realm Dekor, a small online...

22
344
0

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Ngày tải lên : 07/03/2014, 12:20

... broad, black arrows indicate strands, and the black line indicates coiled, unstructured regions The bars at the location of the corresponding amino acids indicate the conﬁdence of the secondary ... proportional to the number of amino acid substitutions Protein names, as listed in the respective database entries, if available, are shown before the species name UniProtKB accession numbers are ... genomic databases using a tailor-made bioinformatics facility The mascot search was run against all proteins and DNA sequence information from public databases FEBS Journal 273 (200 6) 4346–4359 ª 200 6...

14
494
0

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Ngày tải lên : 07/03/2014, 16:20

... promoter activity is boxed, and the GAGA and Adf-1 elements in the DNA are underlined The translation start codon and the main transcription start point are larger and in bold (B) Mutations either in ... that are involved in mitochondrial energy-generating pathways and encoding components of the mitochondrial translation machinery [55] Adf-1 is a transcription factor containing a mybrelated DNA ... within a short element conserved in the transcriptionl initiation site of the bovine a- F1-ATPase gene The region located between the transcription initiation sites and the translation start codon...

11
532
0

Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt

Ngày tải lên : 16/03/2014, 18:20

... globule state of a- lactalbumin a- lactalbumin in the absence of aB-crystallin arises from aggregation of the molten globule state of this protein In the presence of aB-crystallin, the resonance ... the solution of R120G aB-crystallin and a- lactalbumin contained a heavy precipitate, whereas the mixture of wild-type aB-crystallin and a- lactalbumin was clear The sample of reduced a- lactalbumin, ... function by perturbing the putative role of the C-terminal extension in maintaining the integrity of the a- crystallin domain It is possible therefore that a combination of the above factors contributes...

14
366
0

Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

Ngày tải lên : 16/03/2014, 23:20

... c-secretase activity was prepared by extracting carbonate-washed guinea pig brain membranes with 1% CHAPSO A mgÆmL)1 extract was diluted to obtain a ﬁnal concentration of 0.5% CHAPSO, and dilutions ... dimethylsulfoxide in a concentration-dependent fashion Our results indicate that in vitro c-secretase cleavage of APP substrates is inhibited by zinc and that zinc increases the apparent molecular mass of C1013FLAG ... within APP C99 causes oligomerization to a noncleavable state An alternate explanation for the effect of zinc and copper inhibition is an interaction between metals and phospholipid bilayers Zinc...

14
420
0

These Are The Droids You’re Looking For: An Android Guide

Ngày tải lên : 20/03/2014, 00:17

... apps that can run on the phone but also movies and books Most of the apps on the market are free, and can be downloaded by simply touching the install button on the app’s page in the market However, ... constrained to using your phone, navigating the market via a PC is often a good choice Without the constraints of a smartphone display you’ll be able to see more information about apps and navigate ... use their phone frequently as an MP3 player Yet another specific type of media management app is the podcast manager Podcasts are easy to download to phones, but managing them is another matter...

70
362
0

Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf

Ngày tải lên : 29/03/2014, 00:20

... of ANT From these experiments, we concluded that the ANT of our mitochondrial preparations of A franciscana embryos is fully functional ANT of A franciscana is refractory to inhibition by BKA ... a Ca2+-inducible PTP in embryos of A franciscana marks a cornerstone in our understanding of the long-term tolerance, extending for years, to anoxia and diapause, conditions that are invariably ... Yamada A, Yamamoto T, Yoshimura Y, Gouda S, Kawashima S, Yamazaki N, Yamashita K, Kataoka M, Nagata T, Terada H et al (200 9) Ca(2+)-induced permeability transition can be observed even in yeast...

15
505
0

Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot

Ngày tải lên : 29/03/2014, 09:20

... amino acids (aa), a short membrane-spanning region (21 aa) and an intracellular portion (567 aa), containing a kinase homology (KH) domain, the dimerization domain and the C-terminal catalytic ... dramatic increase in the phosphorylation at Ser487 Lastly, a functional role for phosphorylation at Ser487 in the ANPinduced inactivation of GC -A has been demonstrated by engineering a mutation ... cells), again suggesting that the population of receptors fully phosphorylated at these three additional positions was diminished Most remarkably, as already mentioned above, the amount of the two...

14
313
0

A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc

Ngày tải lên : 29/03/2014, 19:20

... were amassed The early 1990s predictions are available in a searchable database online at the site Imagining the Internet: A History and Forecast and they are also the basis for a book by Anderson ... elaborations have been edited Many full elaborations are included in the dozens of extra pages of detail included on the Imagining the Internet online site Among the reports consulted as background ... what it will be in 15 years Data mining of personal traces is in its infancy Automatic facial recognition of video images is in its infancy Surveillance cameras are not all digital, nor are they...

115
441
0

Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

Ngày tải lên : 30/03/2014, 11:20

... transcriptional factor subunits p50 and p65 This binding is speciﬁc and can be abolished by triple mutation of the oligonucleotide, as seen both in the direct binding and during competitive inhibition ... reagents including M199 and fetal bovine serum were obtained from Gibco-BRL (Bethesda, MD, USA) TNFa were obtained from Promega (Madison, WI, USA) All other reagents were obtained from Sigma ... which was then suppressed by cotreatment with NAC These ﬁndings indicate that both TNFa and H2O2 increased intracellular oxidative stress, which was then partially abolished by the antioxidant NAC...

11
393
0

the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009

Ngày tải lên : 10/06/2014, 21:30

... in the context of a satisfying lifelong bond Far from rejecting the value of commitment, almost everyone wants to create a lasting marriage or marriage-like relationship Their afﬁrmation of the ... work amid mounting job demands and a lack of caretaking supports, they are developing second-best fallback strategies as insurance against their worst-case fears In contrast to their ideals, women’s ... single parents not question the advantages of being reared by two happily married parents But they also understand the obvious: happy marriages not break apart, and their own parents were not happily...

312
381
0