0

a systems level proposal for the neural substrates of recall and recognition

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Báo cáo khoa học

... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... to the measured leakage values with graphpad prism software Gas exchange measurement Exchange rates of CO2 were measured with an infrared gas analysis system (Uras G; Hartmann & Braun AG, Frankfurt ... 6phosphate and 40 mm glucose 6-phosphate; 30% KOH was added to the control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, and...
  • 13
  • 707
  • 0
Future R&D Environments A Report for the National Institute of Standards and Technology potx

Future R&D Environments A Report for the National Institute of Standards and Technology potx

Điện - Điện tử

... but also of their size and shape Managing size and shape on the nanoscale allows the creation of a class of materials called nanoparticles These materials have a unique combination of physical, ... genomes of other plant and animal species have been largely in the development of experimental and computational methods for extremely rapid data generation and analysis, as well as in the management ... of information during the next decade, and perhaps not the main part The new techniques for rapid data generation, storage, and analysis of DNA, proteins, and other molecules and cells are providing...
  • 233
  • 408
  • 0
A gene expression database for the molecular pharmacology of cancer pptx

A gene expression database for the molecular pharmacology of cancer pptx

Cơ sở dữ liệu

... for clinical decisions regarding L-asparaginase therapy as well as a closer look at the use of Lasparaginase therapy for solid tumours Discussion We have described the pharmacological implications ... tends to have a sharp boundary Each block of red or blue may represent a causal correlation, an epiphenomenal association or a statistical artefact Appropriate randomization studies can often rule ... collection, and no colour change in the medium was seen in any of the flasks Cells were collected in parallel for RNA, DNA and protein For RNA, the interval from incubator to stabilization of the preparation...
  • 9
  • 484
  • 0
báo cáo hóa học:

báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc

Hóa học - Dầu khí

... classifying a vibration signal as an aspiration when a swallow has actually occurred, whereas a false negative (FN) is the event of classifying a vibration signal as a swallow when an aspiration has actually ... distributed as a standard normal with zero mean and unit variance Hence, at the 5% significance level, |zA| < 1.96 for a stationary signal For a step-by-step procedure for calculating the number of reverse ... below Stationarity Weak stationarity implies that the mean and variance of the signal not change over time Determination of stationarity is important in selecting the appropriate analytical method,...
  • 17
  • 497
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Genetic Programming Method for the Identification of Signal Peptides and Prediction of Their Cleavage Sites David Lennartsson" pot

Báo cáo khoa học

... individual managed equally well on the training and validation cases and actually had a lower fitness on the validation data than on the training set which indicates that there was no overtraining ... than a random guess, the average distance between the predicted cleavage site and the real cleavage site was calculated A GP Method for the Identification of Signal Peptides Table 2: Performance ... time at the task by which they are graded, and the more fit individuals survive and proliferate The solution candidates, or the individuals, have two appearances, the genotype and the phenotype The...
  • 8
  • 430
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx

Báo cáo khoa học

... bit In fact we only demand that the data is arranged in some binary tree The match-bits of a given node are computed as all bits that are not a match-bit in any ancestor and for which all fingerprints ... Multibit tree Again, a too large k will actually slow down the data Figure 11 Fraction of coefficients calculated, different database size The fraction of the database for which the Tanimoto coefficient ... fingerprint is a bitstring of length N Let A and B be bitstrings, and let |A| denote the number of 1-bits in A Let A ∧ B denote the logical and of A and B, that is, A ∧ B is the bitstring that has 1-bits...
  • 10
  • 372
  • 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học

... 165-bp fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGCTACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢ ... Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAATGCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site ... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAATGCGGCCGCTCAGTCCTGCTCCTCGGCCAC-3¢,...
  • 11
  • 668
  • 0
Procedures for the Proper Disposition of Equipment and Materials Through Lion Surplus pot

Procedures for the Proper Disposition of Equipment and Materials Through Lion Surplus pot

Cao đẳng - Đại học

... http://www.ehs.psu.edu/hazmat/battery_disposal.cfm Associated Hazards a Mercury and other heavy metals can cause a variety of health effects including kidney and neurological damage b The acid contained in some batteries ... directional beam of optical radiation of either visible or invisible light b Lasers can be imbedded as part of analytical and other scientific equipment c For additional information and guidance on the ... batteries may be disposed of in the regular trash Examples of batteries that may contain hazardous material Rechargeable Batteries UPS Battery Environmental Protection ~ Occupational Health and...
  • 25
  • 394
  • 0
a means to an end the biological basis of aging and death apr 1999

a means to an end the biological basis of aging and death apr 1999

Vật lý

... of human morbidity and mortality, age-associated degenerative changes in the cardiovascular system are probably most critical, for the obvious reason that all of the other cells of the body are ... senescence and death at the level of individual cells, and for a very good reason Cells are the biological equivalent of the atoms of chemistry, in the sense that they are the smallest thing of which ... combinations And in a very real sense, 30 THE NATURE OF CELLULAR S E N E S C E N C E AND DEATH the death of the macronucleus in paramecia predicts our own corporeal deaths Paramecia had created macronuclei...
  • 246
  • 670
  • 0
Praise for The New Rules of Marketing and PR pps

Praise for The New Rules of Marketing and PR pps

Tiếp thị - Bán hàng

... month for a public relations agency, hundreds of thousands per year for print advertising and glossy collateral materials, and expensive participation at a dozen trade shows a year My team put these ... position The media are critically important for many organizations A positive story in Rolling Stone propels a rock band to fame An article in the Wall Street Journal brands a company as a player A ... browse the site, they may have a general idea of what they want (in my case, perhaps a book for my daughter about surfing), but not the particular title So if I start with a search on Amazon for the...
  • 305
  • 1,370
  • 0
báo cáo khoa học:

báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt

Báo cáo khoa học

... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC GGGCAACGGGAAAGTCCGAAAGCGTGTATAATCTTCAATTTTAGTTGTTTT ... ACTGAAAAAAAATGAAGACTA 32 90 - 100 ED019743 BvMSat08 GAAAAAATAAGTTCAGATCAGATCAGATCA 32 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT BvMSat09 32-39 24 46 - 100 FN424406 AGAAGTATACAAGAACATTAATCAAAATATATAAACAAA ... DX983375 CCTCTAAATGTAAGTGGCTTTAGCAGCACTATAAGTTCTGTGCCTAAAAAA FokI-satellite 130 60 81 - 100 DX979624 GGGACTTAGGAGAGTGACCCAACCAAGGAGGGAGACCTCCTTGGGCTGAGT GGTGGCATTACGGGCAACCAACAATTAGCGACAGGCATATGGTTG...
  • 14
  • 270
  • 0
Practice Guidelines for the Diagnosisand Management of Skin and Soft TissueInfections: 2014 Update by the InfectiousDiseases Society of America

Practice Guidelines for the Diagnosisand Management of Skin and Soft TissueInfections: 2014 Update by the InfectiousDiseases Society of America

Tổng hợp

... appropriate for animal bite wounds? (XV) What is the appropriate treatment of cutaneous anthrax? (XVI) What is the appropriate approach for the evaluation and treatment of bacillary angiomatosis and cat ... revision of the guideline to the SPGC and IDSA board and other collaborating organizations for review and approval 12 • CID • Stevens et al I What Is Appropriate for the Evaluation and Treatment of ... (I) What is appropriate for the evaluation and treatment of impetigo and ecthyma? (II) What is the appropriate evaluation and treatment for cutaneous abscesses, furuncles, carbuncles, and inflamed...
  • 43
  • 621
  • 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

Thời trang - Làm đẹp

... encompasses the region identified by Vartanian and Goel (2004), and has been related with the assessment of the relevance of motivational and emotional information and the regulation of emotional ... et al., 2006) Another major difference among the three studies is the task that participants were asked to perform Kawabata and Zeki (2004) asked their participants to rate the beauty of the ... former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art differ from each other in several different respects, so that the actual factor...
  • 19
  • 526
  • 0
Responding to the unemployment challenge a job guarantee proposal for greece

Responding to the unemployment challenge a job guarantee proposal for greece

Cao đẳng - Đại học

... Luxembourg Hungary Malta Netherlands Austria Poland Portugal Romania Slovenia Slovakia Finland Sweden UK Lithuania Hungary Malta Netherlands Austria Poland Portugal Romania Slovenia Slovakia Finland Sweden ... Switzerland Norway Iceland United Kingdom Sweden Finland Slovakia Slovenia Romania Portugal Poland Austria Netherlands Malta Hungary Luxembourg Lithuania Latvia Cyprus Italy France Croatia Spain ... compliance of all legal labor rights, including sick leave and normal vacation days The combination of the duration of the JG contract and the set minimum wage aims to create a floor for the current...
  • 132
  • 348
  • 0
A review of lean six sigma and malcolm baldrige national quality award and a proposal for the future

A review of lean six sigma and malcolm baldrige national quality award and a proposal for the future

Tổng hợp

... A REVIEW OF LEAN SIX SIGMA AND MALCOLM BALDRIGE NATIONAL QUALITY AWARD AND A PROPOSAL FOR THE FUTURE PNG CHANG LIANG (B.Eng.(Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... Integration of Lean Tools in the DMAIC Framework Table 4.1 Comparing Lean Six Sigma and Malcolm Baldrige National Quality Award on a Conceptual Basis 17 Table 4.2 Comparing Lean Six Sigma and Malcolm ... Malcolm Baldrige National Quality Award on an Execution Basis 18 Table 4.3 Comparing Lean Six Sigma and Malcolm Baldrige National Quality Award on an Impact Basis 19 Table 5.1.1 Quality Criteria Affecting...
  • 83
  • 361
  • 0
EVALUATING a FINAL ENGLISH READING TEST FOR THE STUDENTS AT HANOI, TECHNICAL AND PROFESSIONAL SKILLS TRAINING SCHOOL – HANOI CON

EVALUATING a FINAL ENGLISH READING TEST FOR THE STUDENTS AT HANOI, TECHNICAL AND PROFESSIONAL SKILLS TRAINING SCHOOL – HANOI CON

Khoa học xã hội

... correct Standard deviation is the property of the normal curve Mathematically, it is the square root of the variance of a test Test analysis is the data from test trials are analyzed during the test ... usually consist of essay writing, translation and grammatical analysis The tests, for Heaton, also have a heavy literary and cultural bias He also criticized that public examination i.e secondary ... The research is quantitative in the sense that the data will be collected through the analysis to the scores of the 30 random papers of students at the Faculty of Finance and Accounting To calculate...
  • 60
  • 718
  • 1
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

Tài liệu khác

... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... therefore in this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...
  • 8
  • 517
  • 1
A novel interval method for validating state enclosures of the

A novel interval method for validating state enclosures of the

Báo cáo khoa học

... where m = for Case and m = for Case The interval enclosures for all state variables and the initial approximations xapp,1 (t) and xapp,2 (t) are shown in Fig In the considered time span, the improved ... they are fairly efficient for exactly known initial states and parameters, they are sometimes insufficient for practical scenarios with uncertain but bounded initial states and parameters which have ... p (t) and ∆p (t) are bounded ˙ If the variation rates of these parameters are unknown, the interval bounds ∆p (t) and ∆p (t) are infinite Since the dynamical models for xs (t) and p (t) can be...
  • 12
  • 373
  • 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Kế toán - Kiểm toán

... regulated by state and federal laws The development of useful business information, preparation, and attestation to informative financial information and the production of reliable data for management ... improve the ability of the profession to understand and predict current and future needs for the profession Historically, supply and demand data for the profession and salary history across career ... taught and often are not an active part of faculty professional development plans (Lueddeke 2008; Diamond and Adam 2004) At a time when the costs of a university education are soaring and state...
  • 140
  • 391
  • 0

Xem thêm