a standard le system used in unix and in the

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

Ngày tải lên : 29/05/2014, 15:31
... successful in the Middle East and in Southern Europe The American AMPS standard used the 800 MHz frequency band and was also used in South America, Far East, and in the Asia Pacific region including Australia ... software packages as PageMaker that was then owned by Aldus, a company aptly named after the Italian inventor of the italic typeface The Apple Macintosh was advertised during the 1984 Superbowl, and ... of a company using balance sheets and profit and loss 35 Anonymous class accounts, and may also make certain forecasts regarding growth It is typically used by business analysts and investors and...
  • 379
  • 3.5K
  • 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

Ngày tải lên : 20/02/2014, 12:20
... fields from the database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech ... Figure System architecture The underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant ... speech and handwriting, the interface also supports more traditional graphical user interface (GUI) commands In the details panel, the actors and directors are presented as buttons Pointing at (i.e.,...
  • 8
  • 585
  • 0
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

Ngày tải lên : 08/03/2014, 04:22
... Table contains a random sample The primary function of this training feature in NaturallySpeaking is to add new words to the lexicon; the nature of the other adaptations is not clearly documented ... could also improve recall For example, Q245 What city in Australia has rain forests? it answered correctly, but the transcription What city in Australia has rainforests (without a space), got no answers ... speech and the longer latency in mobile data networks We have now implemented a multi-level caching system to increase speed Our cache system currently contains two levels The first is a cache of...
  • 4
  • 276
  • 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Ngày tải lên : 08/03/2014, 06:20
... component applying morphological and phonological rules to arrive at the representation used as input for speech synthesis A distinguishing feature of the grammar used in the generator is the integration ... formalism and the same ratification machinery as the grammar 1042 formation like (potential) accent and syllable boundary positions Input to the synthesizer is a SAMPA string enriched with qualitative ... we have access to the wealth of phonological research undertaken in the tone sequence paradigm The handling of accentuation and phrmsing by the generator resembles the syntacto-semantic approaches...
  • 5
  • 498
  • 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Ngày tải lên : 16/03/2014, 20:20
... application obtains the measures for all the metrics and levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis ... between the source and any of the candidates The alignments are also visualized along with the rest of the annotations, and they can be also used to calculate artificial annotations projected from the ... the grammatical categories of the words in the sentence and display the information they contain Figure and show, respectively, several annotation levels of the sentences in the example and the...
  • 6
  • 453
  • 0
Lab 3.1.5 Configuring a Serial Interface

Lab 3.1.5 Configuring a Serial Interface

Ngày tải lên : 05/11/2013, 12:15
... router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: ... Configure the name and passwords for Router a On Router 1, enter the global configuration mode and configure the hostname as shown in the chart b Configure the console, virtual terminal and enable passwords ... interface on GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details...
  • 5
  • 341
  • 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Ngày tải lên : 11/12/2013, 13:15
... router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: ... a On Router 1, enter the global configuration mode and configure the hostname as shown in the chart b Configure the console, virtual terminal and enable passwords If there are any problems, ... interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least following details discovered by issuing this command c...
  • 5
  • 535
  • 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Ngày tải lên : 11/12/2013, 13:15
... include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used ... following according to the chart: • The hostname • The console • The virtual terminal • The enable passwords If there is a problem completing this, refer to the Network Address Translation (NAT) configuration ... Remove the clock rate statement from the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show...
  • 6
  • 368
  • 0
Tài liệu Troubleshooting a Serial Interface doc

Tài liệu Troubleshooting a Serial Interface doc

Ngày tải lên : 11/12/2013, 15:15
... include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used ... following according to the chart: • The hostname • The console • The virtual terminal • The enable passwords If there is a problem completing this, refer to the Network Address Translation (NAT) configuration ... Remove the clock rate statement from the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show...
  • 6
  • 275
  • 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Ngày tải lên : 18/01/2014, 04:20
... router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: ... a On Router 1, enter the global configuration mode and configure the hostname as shown in the chart b Configure the console, virtual terminal and enable passwords If there are any problems, ... interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least following details discovered by issuing this command c...
  • 5
  • 431
  • 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Ngày tải lên : 24/01/2014, 19:20
... include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used ... following according to the chart: • The hostname • The console • The virtual terminal • The enable passwords If there is a problem completing this, refer to the Network Address Translation (NAT) configuration ... Remove the clock rate statement from the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show...
  • 6
  • 323
  • 0
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Ngày tải lên : 20/02/2014, 05:20
... on the other hand, shows the magnitude of the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel ... singularities The shrinkage procedure makes the class covariances closer to the overall data covariance, and therefore to each other, thus making the quadratic boundary more similar to a linear ... small sample sizes and high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial...
  • 6
  • 551
  • 0
Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx

Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx

Ngày tải lên : 31/07/2014, 11:20
... cấu tạo giống 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~  Mạch ASIC ( Application Specific Integrated Circuit ): não ổ đ a Flash USB Nó gồm có xử lý trung tâm 50 MHz ARM7 RISC, quản lý toàn chuyện ghi ...  Bộ dao động tinh thể ( Crystal Oscillation ) sản xuất tín hiệu dạng đồng hồ dành cho xử lý trung tâm ASIC Tất thành phần khác mạch in tự đồng tần số với phần dao động tinh thể  Đèn LED nhỏ ... QUAN VỀ USB ~^~ 13 * ỨNG D ỤNG C A C ỔNG USB Quạt USB hãng ThinkGeek Gạt tàn USB hãng ThinkGeek Chiếc quạt để bàn USB, với cánh mềm cổ quay linh hoạt theo kiểu quạt tai voi mà người Việt Nam...
  • 19
  • 471
  • 1
AN1157   a serial bootloader for PIC24F devices

AN1157 a serial bootloader for PIC24F devices

Ngày tải lên : 11/01/2016, 16:47
... Escape Control characters are not considered data and are not included in the checksum COMMANDS The data field for each packet contains one command and its associated data The commands are detailed ... value that could be interpreted in the data field as a control character Within the data field, the bootloader will always accept the byte following a as data, and will always send a ... nonvolatile memory: program Flash, data EEPROM and Configuration bits Additionally, there are commands for special operations, such as repeating the last command, replicating the data and resetting...
  • 26
  • 532
  • 0
Serial Interface (SCI)

Serial Interface (SCI)

Ngày tải lên : 29/09/2013, 11:20
... SCI, the data to be transmitted are written in the TDR and the received data are read from the RDR Although the TSR and RSR exist inside the SCI, they are not assigned an address in the memory since ... use as a counter A CR (Carriage Return) code and a LF (Line Feed) code are transmitted to effect a line feed after each line of data has printed The CR and LF are represented by H'0D and H' 0A, ... http://resource.renesas.com Page 141 http://resource.renesas.com Page 142 What are the characteristics of serial data input/output compared with that of parallel data? Enter an appropriate word in parentheses Answer...
  • 18
  • 289
  • 0
Serial Interface to PIC

Serial Interface to PIC

Ngày tải lên : 03/10/2013, 01:20
... of sharewares which is doing the same things The download URLs are given in the references [41, 42] In fact they have more capabilities than that included in MS Windows [43] The main advantage ... to MAX-232 for achieving compatibility Online tutorials for indepth information regarding the RS-232 and MAX-232 are available on Internet [47, 48] The DB-9 (also called as DE-9 D-sub 9-pin connector) ... It is available at fairly low cost owing to the trimming and calibration at the wafer level Moreover the low output impedance of LM35, in addition to the higly linear output, and precise inherent...
  • 10
  • 271
  • 0
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

Ngày tải lên : 22/02/2014, 02:20
... develop a text-based search engine module capable of handling files in the xml format and accessed by local and remote users The core implementation is actually a web application, mainly based on the ... structure, while multilingual files can easily be handled during indexing and searching phases; S Whittaker and M Walker 1991 Toward a theory of multi-modal interaction In Proceedings of the National Conference ... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating...
  • 4
  • 294
  • 0
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

Ngày tải lên : 31/03/2014, 03:20
... recording; and the browsing of programrelated information from Internet All of these functions can be operated through spoken natural language interactions The main processing modules of the system ... with a super-unidirectional microphone and a speaker, and communicates and activates the speech recognition and voice synthesis, and dialogue processing of the system The IFR has been given the appearance ... appearance of a stuffed animal One advantage of this IFR is that it can be directly touched and manipulated to create a feeling of warmth and closeness On hearing a greeting or being called by...
  • 4
  • 271
  • 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Ngày tải lên : 18/06/2014, 18:20
... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... ACTGTTCAAGCCTCCAAGCTGTGCCTTGG GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
  • 7
  • 404
  • 0