... 788–7 93 (AAUAUA) and 138 6– 139 1 (AAUAAA) The first signal (AAUAUA) is located just 19 bp upstream of the poly (A) tail of the shorter transcript and the second one is located 46 bp upstream of the ... analysis of the Cc RNase cDNA 02 sequence revealed that two putative polyadenylation signals are found in the 3 UTR, located at nucleotide positions 788–7 93 (AAUAUA) and 138 6– 139 1 (AAUAAA) The ... purified and characterized as alkaline [12] and acidic RNases [ 13] , anda third poly(U)- and poly(C)-specific ribonuclease has also been isolated and characterized [14, 15] In order to further characterize...
... C54 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ... to each sample and aliquots of the separated phases were analyzed on a 13% SDS ⁄ PAGE gel Preparation of nuclear and cytoplasmic extracts Nuclear and cytoplasmic extracts from monolayers of Huh-7...
... C-terminal part of p 35 Abnormal conversion of p 35 to p 25 may increase p 25 level and dislocate p 25 causing Cdk5 sequestered from normal regulation system and concentrated at abnormal sites Thus, Cdk5 ... literature of the Cdk5/p 35 pathway, when talking about the cleavage of p 35 , almost all attention was drawn to p 25, the C-terminal cleavage fragment of p 35 Another cleavage subunit p10 has been long neglected ... levels As phosphorylation of β-catenin by p 35 / Cdk5 influence the association of presenilin-1 and β-catenin (Kesavapany et al., 2001) The deregulation of this pathway may associate with the cause of...
... C-terminal part of p 35 Abnormal conversion of p 35 to p 25 may increase p 25 level and dislocate p 25 causing Cdk5 sequestered from normal regulation system and concentrated at abnormal sites Thus, Cdk5 ... literature of the Cdk5/p 35 pathway, when talking about the cleavage of p 35 , almost all attention was drawn to p 25, the C-terminal cleavage fragment of p 35 Another cleavage subunit p10 has been long neglected ... levels As phosphorylation of β-catenin by p 35 / Cdk5 influence the association of presenilin-1 and β-catenin (Kesavapany et al., 2001) The deregulation of this pathway may associate with the cause of...
... ZmSUN3 6 13 68 4.9 TM1, L 33- V 55 TM2, L 555 -M577 TM3, L599-I612 F 233 -D 35 7 (2 e -38 ) A4 82-F5 15 G 437 -G474 ZmSUN4 639 71 5. 2 F 257 -D381 (7 e -38 ) D514-E 539 G4 63- G500 ZmSUN5 58 9 64 5.3 TM1, TM2, TM3, TM1, ... presence ofa C-terminal SUN domainand the NE localization are among the defining features of animal and fungal SUN proteins [9, 13, 38] Plant genomes therefore appear to encode canonical C-terminal ... Each of these two subfamilies comprises at least twogenes ZmSUN1 and ZmSUN2 are CCSD-type and are most closely related to plant SUNdomain homologs AtSUN1, AtSUN2, and OsSad1 ZmSUN3, 4, and are...
... both active and passive P300 latency and age; in this same study, levels of active latency were associated with concentration ability, and passive latency with verbal proficiency and recall [72] ... broad-based alteration of P300 activation P300 activity is modulated by the internal physiologic state of subjects, from natural circadian and ultradian rhythms to levels of fatigue or physical ... auditory passive single- tone and passive oddball paradigms may similarly be effective when active responses are infeasible [ 63] Further, P300 parameters may be affected by familiarization with repeated...
... methylation of GPR 150 , ITGA8 and HOXD11 in ovarian cancers Life Sci 80, 1 458 –14 65 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a possible ... and tetramers Science 2 03, 174– 176 21 Gayathri P, Sujay Subbayya IN, Ashok CS, Selvi TS, Balaram H & Murthy MR (2008) Crystal structure ofa chimera of human and Plasmodium falciparum hypoxanthine ... Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phosphoribosyltransferases is examined using saturation mutagenesis, functional analysis, and X-ray crystallography...
... production ofa Histagged SaDHNA The primers for the PCR were 5 -GG AATTCCATATGCAAGACACAATCTTTCTTAAAG -3 (forward primer witha Nde I site) and5 -CGGGATCCT CATTTATTCTCCCTCACTATTTC -3 (reverse primer with ... The Authors Journal compilation ª 2007 FEBS 2249 Mechanism and kinetics of dihydroneopterin aldolase Y Wang et al 5 -GGAATTCCATATGGATATTGTATTTATAGAGCA AC -3 (forward primer witha Nde I site) and ... solution at an emission wavelength of 430 nm and an excitation wavelength of 33 0 nm for HP and at an emission wavelength of 446 nm and an excitation wavelength of 36 0 nm for HPO The emission and excitation...
... of C-terminal domainof LPL In vitro product of C-terminal domain Heparin a nity NaCl (M) Wild type K38 1A R40 5A K40 7A K41 3A/ K41 4A K41 4A K42 2A K42 8A K 43 0A W39 3A/ W39 4A 0.48 0.46 0 .33 0 .39 0.26 No ... were measured for heparin affinity (Table 1) The C-terminal domainof wild-type LPL (amino acid residues 31 3–448) or its mutants, K38 1A, R40 5A, K40 7A, K41 3A/ K41 4A, K42 2A, K42 8A, and K 43 0A, was applied ... the media, was assayed for catalytic activity The lipase (A) and esterase (B) activities of the substituted mutants, R40 5A, K41 3A, K41 3A/ K41 4A, K41 4A, and S 132 T, are presented as specific activities...
... like Sancho Panza's island All real mankind, past, present, and future, has similarly been swept away and replaced by a miraculous race of Amadises, Lisvarts, Galaors, Gradasilias, Orianas, Pintiquinestras, ... piles of cabbage and cauli-flowers, the rows of tin ware and copper saucepans, the heaps of maccaroni and pastes, of spices and drugs; the garlands of onions and red peppers and piles of apples; ... of paladins and knights, move two colossal mailed and vizored figures Roland, whom the Italians call Orlando and the Spaniards Roldan, the son of Milon d'Angers andof Charlemagne's sister; and...
... bold) Name Length (bp) Sequence 1IR 1DR 1DR-short 39 45 30 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT ATACCCGGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC GCCCGGGTTTAAAGGGGACAGATTCAGGCC A D B E C F 53 96 Fig ... experimental data and resulting ts In the case of AEDANS, individual analysis of 480 and 53 0 nm decays gave very similar lifetime values Therefore, anisotropy data from two emission wavelengths (480 and ... Atto 532 Atto 532 homoă FRET was calculated using Eqn (2), with FD (FAtto 532 ) = 0.9 and calculating the overlap integral between Atto 532 emission and excitation using spectral data provided by the manufacturer...
... cDNA to genomic DNA sequence is relaced by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5 - and3 -UTR are underlined and the 13 repeats witha consensus of CCAATGATGATCCAAGAAATCCACACTACAG ... generated following cleavage of the signal peptide is 178 amino acids witha calculated molecular mass of 20 .5 kDa anda theoretical pI of 9. 83 A potential N-linked glycosylation site was also ... IL-11 translation had 204 amino acids, a calculated molecular mass of 23. 3 kDa anda theoretical isoelectric point (pI) of 9.77 A signal peptide of 26 amino acids was predicted [32 ] Thus the mature...
... standard procedures [47] Accordingly, template for the production of sense RNA was amplified with the primers 5 -CAGAGATGCATAATACGACTCACTATAGG GAGAAACCCAGAAAGTGATGAG -3 and5 -TAGAA CTAAGCGAGCATG -3 , ... CTAAGCGAGCATG -3 , whereas the template for the production of the antisense strand was amplified using the primers 5 -CAGAGATGCATAATACGACTCACTATAG GGAGATAGAACTAAGCGAGCATG -3 and5 -AACC CAGAAAGTGATGAG -3 ... Bacterial expression of recombinant Stk 33 A Stk 33- cDNA was amplified with expand long template PCR-system (Roche) using the forward 5 -GAGCAAT GTCACAGTAGG -3 and reverse 5 -TGCAGATGGAC TGTAGAC -3 ...
... GT1-F, 5 -CCTGATCGACGCACGAGT -3 and GT1-R, 5 -TTTTGCAAGTCATAGTAATCAGTTT -3 for GTcDNA1 (2 150 bp); and GT2-F, 5 -CACCAGCAACTAC CTGATCGA -3 and GT2-R, 5 -CACAAAATATGCTT CCAAGTGC -3 for GT-cDNA2 (30 43 ... GLUT1 (AAB02 037 ); mouse GLUT1 (AAA37 752 ); rat GLUT1 (P11167) rabbit GLUT1 (P 13 35 5 ); bovine GLUT1 (P27674); human GLUT1 (AAA5 257 1); rtGLUT2 (AAK0 937 7); chicken GLUT2 (Q9 059 2); human GLUT2 (AAA5 951 4); ... than the former (data not shown) Further analysis of the ORF showed that it encodes a putative polypeptide of 53 3 amino acids, witha predicted molecular mass of 57 kDa anda pI of 8 .34 A database...
... al [17] Antimicrobial and haemolytic activity PG-1, IB -36 7, BM-1 and BM-2 were characterized with regard to their antibacterial activity against Gram-positive bacteria, Gram-negative bacteria ... Distance constraints and coupling constants were used in the habas program [ 53 ] of the dyana package [ 53 ] to generate /, w and v1 dihedral angle constraints and stereospecific assignments Dihedral ... more active than IB -36 7 against Gram-positive bacteria and fungi, showing better inhibition than IB -36 7 of S aureus, S epidermidis and fungi The antimicrobial activity of IB -36 7 and BM-1 against...
... 5 -AGATTTGGGGATAC TTCATCTAGCTCAATTT -3 , antisense 5 -AGATGAAGT ATCCCCAAATCTATGTAACG -3 ; N424H, sense 5 -AGATTTGGGCATACTTCATCTAGCTCA -3 , antisense 5 -AGATGAAGTATGCCCAAATCTATGTAA CG -3 PCR reactions ... residue 1 15 in FAE1 KCS (T1 15- FAE1 KCS) a sense primer 5 -GAACGTGTTGGTTCCGC GTGGTAGCGCATGTGATGATCCGTCCTCG -3 and an antisense primer 5 -CACATGCGCTACCACGCGG AACCAACACGTTCCGTGAAGAAGTATC -3 were used ... (Clontech, Palo Alto, CA, USA), flanking primers used were an antisense 5 -CGTCAAG GAGAAAAAACCTCTAGCCGAAT -3 primer and an universal T7 sense primer To insert a thrombin cleavage site at amino-acid residue...