a single source for services

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

... can be seen that for a high nominal current density, a high fraction of the current is generated at the catalyst layer near the air inlet area, leading to under-utilization of the catalyst at ... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... Catalyst layers The catalyst layer is treated as a thin interface, where sink and source terms for the reactants are implemented Due to the infinitesimal thickness, the source terms are actually...

18
549
0

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Danh mục: Môi trường

... fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals, and insecticides Wheat straw contains ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... temperature steam or water with or without acid catalyst During the pretreatments, internally produced acids also serve as a catalyst (“autohydrolysis”) Acid catalyzed hydrolysis and partial degradation...

20
437
0

Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

Danh mục: Hóa học - Dầu khí

... subject was placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and CSF viral loads to below detectable ... Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, nonpeptide CCR5 antagonist with highly potent and ... demonstrated major variants in C18L that were distinct from a single variant present in C18E; major variants in C98L that were distinct from a single major variant present in C98E; and major variants...

12
401
0

Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx

Danh mục: Hóa học - Dầu khí

... General Clinical Research Centers Abbott Laboratories, Amylin Pharmaceutical, AstraZeneca Pharmaceuticals LP, Bayer HealthCare LLC, Closer Healthcare, GlaxoSmithKline Pharmaceuticals, King Pharmaceuticals, ... an age- and gender-balanced population of 100 healthy adults a monocentric German study Clin Immunol 2005, 116:192-197 15 Tani S, Nagao K, Anazawa T, Kawamata H, Furuya S, Takahashi H, Iida K, ... purification, the DNA was quantitated on a NanoDrop 8000, to measure concentration and assess the purity of the DNA through standard A2 60 /A2 80 and A2 60 /A2 30 ratios The DNA was diluted to 400 ul total,...

8
370
0

báo cáo hóa học:" Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" doc

Danh mục: Hóa học - Dầu khí

... General Clinical Research Centers Abbott Laboratories, Amylin Pharmaceutical, AstraZeneca Pharmaceuticals LP, Bayer HealthCare LLC, Closer Healthcare, GlaxoSmithKline Pharmaceuticals, King Pharmaceuticals, ... an age- and gender-balanced population of 100 healthy adults a monocentric German study Clin Immunol 2005, 116:192-197 15 Tani S, Nagao K, Anazawa T, Kawamata H, Furuya S, Takahashi H, Iida K, ... purification, the DNA was quantitated on a NanoDrop 8000, to measure concentration and assess the purity of the DNA through standard A2 60 /A2 80 and A2 60 /A2 30 ratios The DNA was diluted to 400 ul total,...

8
453
0

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Danh mục: Báo cáo khoa học

... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... formation By contrast, using hexadecylamine or oleylamine as a reaction solvent promotes Sn(Et2Dtc)2 decomposition at temperature as low as 85 °C Alkylamines also act as a stabilizing agent for ... metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not result in SnS formation...

5
365
0

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Danh mục: Báo cáo khoa học

... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... formation By contrast, using hexadecylamine or oleylamine as a reaction solvent promotes Sn(Et2Dtc)2 decomposition at temperature as low as 85 °C Alkylamines also act as a stabilizing agent for ... metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not result in SnS formation...

5
276
0

Báo cáo y học: " A single site for N-linked glycosylation in the envelope glycoprotein of feline immunodeficiency virus modulates the virus-receptor interaction" ppt

Danh mục: Báo cáo khoa học

... 16 (page number not for citation purposes) Retrovirology 2008, 5:77 GATTTTTAAGGTATTC (5' MLU) and either 5'-CGAGATATTATAACAGATGTTATTAGCACAT-3' (ENV 7076) or 5' GGTCTTGAATCTGTGAAGTGTACCACATA (ENV ... by amplifying the SU coding sequence with the oligonucleotide primers 5'-CGATCTAGAAACAATAATTATGGCAGAAG-3' and 5'-GGCGGCCGCTGGTACCAC(C/T)AAGTAATC-3' corresponding to the start codon for Env leader ... [37-42] Accordingly, the FL4 cell line has provided the basis for the first commercially available FIV vaccine (Fel-O-Vax FIV, Fort Dodge), approved for use in the USA, Japan, New Zealand and Australia...

16
428
0

Báo cáo sinh học: "Immediate transfection of patient-derived leukemia: a novel source for generating cell-based vaccines" ppt

Danh mục: Báo cáo khoa học

... both a cytokine and a chemokine transgene (IL-2 and lymphotactin) by a single human neuroblastoma cell line is a recent example of this strategy [7] The disadvantage of a single cell line approach ... involvement For example, the large amount of tumor material typically available from leukemia patients makes these cells accessible for autologous patient-derived vaccine production A major hurdle ... U2OS cells Nuclear DNA was harvested and amplified from separate samples, error bars indicate the standard deviation from the average of triplicate samples pattern of cell division rates in nucleofected...

13
256
0

evaluate potential use of gut weed (enteromorpha sp.) as a food source for tilapia (oreochromis niloticus): affect on survival and growth

Danh mục: Tổng hợp

... same as experiment Statistical analysis Data for all measured parameters were analyzed using Excel, and SPSS for Windows, Version 18.0 Variations from dietary treatment were compared by one way ANOVA ... world Tilapia production were Nile Tilapia Production of Tilapia in Vietnam has been increasing year by year; the farming area has been expanded In 2009, the area of tilapia reached 29,717 ha, production ... values are in the range for normal growth of Tilapia 4.3.2 Survival and Growth performance Survival of Tilapia was not affected by the feeding treatments; all treatments had 100% survival (Table...

44
243
0

Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Danh mục: Môi trường

... have the same physicochemical and biological structures as natural tidal flats, and that silt accumulation in the sediment is a key parameter for the creation of a natural-like artificial tidal ... observed variation in the macrobenthos population in the artificial tidal flats and the natural tidal flat The abundance of macrobenthos in the artificial tidal flats increased after May 28 and finally ... paper sludge ash and its beneficial applications for cleaning Ago Bay, Kami Pa Gikyoshi/Japan Tappi Journal, 60(9), 80-88 (in Japanese) Ishii R., Sekiguchi H., Nakahara Y., Jinnai Y (2001) Larval...

13
586
0

Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx

Danh mục: Điện - Điện tử

... governments and rural development staff; Very scare information and documents (books, guidebooks, manuals, ) Awareness the uncontrolled and libertine sanitation situation in rural area was a population ... separated urine as mineral fertilizer Poster Bonn University, Germany Vietnam National program on Clean water and Rural sanitation (2002) Objectives of national strategies on clean water and ... special in rural areas  Urine may lead a bad smell if having a careless treatment  Urine fertilizer production organization is not easy to persuade farmers, commercial investors and local government...

7
476
1

BAMBOO AS A NEW FIBER SOURCE IN THE US PAPER INDUSTRY: A FEASIBILITY ANALYSIS FOR BOOSHOOT GARDENS, LLC docx

Danh mục: Tự động hóa

... fiber than Booshoot can provide Booshoot can make up for a lack of company resources and capacity by commissioning research on the ideal bamboo for paper pulp as well as information on any unforeseen ... chain listed above For example, if bamboo paper is cheaper and functions well in a variety of end products demand for bamboo paper motivates paper and pulp mills to purchase bamboo as a raw material ... generally dictate demand for paper rolls, with an increase in 67 manufacturing output being favorable for paper manufacturers The state of downstream demand causes significant shifts at each stage of...

84
472
0

Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc

Danh mục: Tiếp thị - Bán hàng

... Rabobank ■ Rand Merchant Bank (SA) ■ Rating Agency Malaysia ■ Raiffeisen International and RZB ■ Saudi Arabian Monetary Agency ■ Shell ■ Société Générale ■ Standard Chartered Group ■ State Bank ... of Banks, Financial Institutions and Corporates worldwide Some of our clients: ■ ABSA ■ Alpha Bank ■ Axa Investment Managers ■ Bank BPH SA ■ Bank of America ■ Bank of China ■ Bank of Kuwait and ... the Middle East ■ Bank Pekao SA ■ Bank Zachodni WBK SA ■ BBVA Group ■ BNP Paribas ■ Calyon ■ Central Bank of Kuwait ■ Caixa Geral de Depositos ■ China International Capital Corporation ■ Citigroup...

8
453
1

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Danh mục: Báo cáo khoa học

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

11
679
0

Báo cáo khoa học: "A Joint Source-Channel Model for Machine Transliteration" doc

Danh mục: Báo cáo khoa học

... Chinese characters, due to homophone confusion Unlike Japanese katakana or Korean alphabet, Chinese characters are more ideographic than phonetic To arrive at an appropriate Chinese transliteration, ... to capture how source names can be mapped to target names, but rather how source and target names can be generated simultaneously In other words, we estimate a joint probability model that can ... description than that of NCM The actual size of models largely depends on the availability of training data In Table 1, one can get an idea of how they unfold in a real scenario With adequately sufficient...

8
289
0

Báo cáo hóa học: " Research Article Fully Adaptive Clutter Suppression for Airborne Multichannel Phase Array Radar Using a Single A/D Converter" potx

Danh mục: Hóa học - Dầu khí

... to achieve full adaptivity to the clutter, generally the radar system has to undergo a multiple -A/ D (hardware) upgrade where a number of sampled data streams are made available However, for practical ... variance and E{·} denotes the expectation operator The usual assumptions such as patchto-patch statistical independence (zero-mean Gaussian) are made on the clutter as well as target The data ... extensive simulation Another observation based on simulation data as well as MCARM data is that the order of pattern ratio is best to be around half the total number of sensors in the array In our...

14
342
0

Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

Danh mục: Hóa học - Dầu khí

... reached It may be mentioned here that p, q are all matrices γm and τm are real values corresponding to a particular source position and σ is also a real value As already mentioned, we use the albedo ... no relative motion between the camera and the object, the PSF remains same for all the observations We also assume that the blur is space-invariant, and hence a single blur mask is assumed for ... satisﬁed We subtract a small value ε from the values sx and s y (estimated geometrically from the image) as these values are already close to the true values Since sx and s y are already normalized...

12
379
0

Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx

Danh mục: Hóa học - Dầu khí

... spectrophotometer at room temperature and in a backscattering geometry, with Ar laser at 514.5 nm Results and Discussion Figure shows the Raman spectra for materials grown at different growth temperature (a: ... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a ﬂow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for ... 10.1103/PhysRevLett.86.131 M Kruger, M.R Buitelaar, T Nussbaumer et al., Appl Phys Lett 78, 1291 (2001) doi:10.1063/1.1350427 N Rajalakshmi, K.S Dhathathreyan, A Govindaraj et al., Electrochim Acta 45, 4511 (2000) doi:10.1016/S0013-4686...

4
395
0