a shape tween of a moving vertical swirl is on the mask layer the diver image is on the masked layer
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
Ngày tải lên :
05/09/2013, 17:03
... (9) In equations (6)-(9), Xm is the location where the far wake model is coupled to the near wake, Dm is the diameter of the wake at Xm and um is the velocity in the wake at Xm Xm is given by: ... Termination: There are several ways to define the termination condition In this work, a convergence criterion is applied; when most of the individuals reach an approximately the same fitness value ... generation from the last generation (2) Mutation: In order to maintain genetic diversity, some of the individuals in the group are randomly altered After that, the new generation is finally created...
- 12
- 635
- 1
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
Ngày tải lên :
16/03/2014, 16:20
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...
- 12
- 512
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 2
Ngày tải lên :
10/09/2015, 15:54
... inertia meters and gyrometers are available in the market today that can monitor translational and rotational motions, as well as response velocities and accelerations Measuring motion responses ... 114 of Chapter Based on the above observations, it is clear that the spatial features of the flow around and in the wake of the bluff upstream cylinder remain invariant over successive wave period ... using a specially designed and built constant speed tow carriage system with vibration suppression ability In particular, vibrations in the carriage chassis have been successfully isolated to a large...
- 108
- 275
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 1
Ngày tải lên :
10/09/2015, 15:54
... wake (A) Laminar boundary layer separation 300 < Re < 300K Subcritical Regime Present Study f (A) Laminar boundary layer separation (B) Turbulent boundary layer separation but boundary layer is ... Benchmarking of measured physical parameters and flow visualization from experiments and CFD simulations, i Evaluate physics of the flow around and in the wake of the cylinder, and establish relationships ... flow and forces at a critical spacing of 3.5D The first flow pattern was associated with little flow in the gap between the cylinders and reattachment of separated shear layers, while the second...
- 195
- 474
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 3
Ngày tải lên :
10/09/2015, 15:54
... D offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T=0.7 s, H = 25 mm, C = 50 mm/s Figure D3 Y direction velocities measured at y = offset, at spacing of (a) ... measured at y = offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for wave only run, T = 0.7 s, H = 25 mm Figure D14 X direction velocities measured at y = 0.6 D offset, at spacing of (a) ½ D, ... D16 Y direction velocities measured at y = 0.6 D offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for wave only run, T = 0.7 s, H = 25 mm 318 Plots of Kinematics in the Wake of Upstream Cylinder...
- 64
- 231
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 4
Ngày tải lên :
10/09/2015, 15:54
... increment at steady state beating Wave only, T = 0.7 s run Downstream cylinder placed at x = ½ D, y = 373 Appendix H Iso Surface Plots of Numerical Wave Tank Figure H1 Iso surface plots of wave and ... T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H8 Iso surface plots of wave only run, T = 0.7s, at time intervals of T (At Steady State Downstream cylinder spacing ... surface plots of wave and currents run, C =50mm/s, T =0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H6 Iso surface plots of wave and...
- 57
- 228
- 0
CLASSIFICATION OF SOLUTIONS FOR A SYSTEM OF INTEGRAL 2 EQUATIONS WITH NEGATIVE EXPONENTS VIA THE METHOD OF 3 MOVING SPHERES
Ngày tải lên :
14/10/2015, 07:54
... Classification of solutions of higher order conformally invariant equations, Math Ann 313 (1999), pp 207–228 [ZhaHao08] Y Z HANG , J H AO, A remark on an integral equation via the method of moving ... concerning the equivalence of integral and differential equations In the literature, to classify solutions of some partial differential equations, people usually use one of the following two methods: moving ... directly rather than going the second step as in the method of moving planes, see [Li04, Section 1] It is worth noticing that all these “traditional” methods of moving planes and spheres can be used...
- 15
- 243
- 0
VIBRATION OF FUNCTIONALLY GRADED SANDWICH BEAMS EXCITED BY a MOVING h ARMONIC POINT LOAD DAO ĐỘNG của dầm SANDWICH có cơ TÍNH BIẾN THIÊN CHỊU KÍCH ĐỘNG của lực điều hòa DI ĐỘNG
Ngày tải lên :
08/06/2016, 13:00
... decreased, and this leads to the lower frequency of the beam The reduction in the fundamental frequency of the beam by raising the h C /h ratio can be explained by the same reason as by raising the ... harmonic point load A simply supported beam composed of Aluminum (Al – metal phase) core and AluminumAlumina (Al-Al O ) FG layers is considered in this section The material data for Aluminum and ... traditional ductile metals remarkably enhances the vibration characteristics of the structures The investigations on the dynamic response of FG beams [5-8] in recent years have shown that the...
- 8
- 656
- 0
(SPE 89414 MS) A Simple Approximate Method to Predict Inflow Performance of Selectively Perforated Vertical Wells
Ngày tải lên :
26/09/2016, 11:23
... 22 The main advantage of the 3D solution is that it could handle arbitrary perforation distribution and non-uniform perforation parameters SPE 89414 A software package called SPAN is also available ... perforation designs on the well performance Table lists the completion and perforation data considerd for the SPW The rest of the basic data set is the same as that tabulated in Table The well is perforated ... perforations pierce through SPE 89414 the formation damage zone and communicate with the undamaged formation beyond the damaged zone Nomenclature A = drainage area, ft2 Bo = formation volume factor,...
- 11
- 367
- 0
Hydrokinetic Energy Conversion Systems And Assessment Of Horizontal And Vertical Axis Turbines For River And Tidal Applications A Technology Status Review
Ngày tải lên :
24/11/2016, 10:42
... Ltd., ON, Canada Amazon AquachargerTM, Marlec Engineering, UK AquanatorTM Atlantis Energy, Australia Atlantisstrom, Germany Bangladesh Univ of Engg & Tech, Dhaka, Bangladesh BioPower Systems, Australia ... information is available for many locations, water velocity varies from one potential site to the other depending on the cross-sectional area Therefore, unless a correlation between flow variations ... Use of ducts and applications The present trend clearly indicates that the area of multiple application (such as, river, tidal, artificial waterways, dam tailrace, and industrial outflows) is of...
- 13
- 743
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
Ngày tải lên :
25/10/2012, 11:00
... and after the initiation of NARP can be seen in table A negative correlation was observed between the ceftriaxone consumption and the prevalence of ceftriaxone resistant E.coli and Klebsiella ... two-tailed Spearmans coefficient (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods ... evaluate the consumption because of some concerns The DDD is a technical unit which is the assumed average maintenance dose per day for the drugs main indication in adults and is assigned by the...
- 6
- 692
- 0
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"
Ngày tải lên :
25/10/2012, 11:40
... Asian Morita S[29] 1998 Japan Asian van Lieshout EM[30] 1999 The Netherlands Caucasian Tan W&[31] 2000 China Asian Lee JM[22] 2000 China(Taiwan) Asian Casson AG[21] 2003 Canada Caucasian Roth MJ[32] ... stress such as DNA damage and oncogene activation, the p53 protein accumulates rapidly through posttranscriptional mechanisms and is also activated as a transcriptional factor, which leads to cell ... MJ[32] 2004 China Asian Casson AG[20] 2006 Canada Caucasian Cai L[25] 2006 China Asian Murphy SJ[33] 2007 Irish Caucasian Canova C[19] 2009 European Caucasian SNP site Sample size HWE MAF Genotypic...
- 9
- 615
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
Ngày tải lên :
26/10/2012, 10:03
... DWECS/DREAM [14]; a merger between the Danish Work Environment Cohort Study (DWECS) and the national register on social transfer payments (DREAM) DREAM is a register based on data from the Danish Ministry ... Analysis Logistic regression methods were used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was ... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of...
- 6
- 578
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2
Ngày tải lên :
07/11/2012, 14:17
... FEATURES OF THE INTERNATIONAL CONVENTION ON HUMAN RIGHTS IN COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4.2 20 Purposes and typical legal ... Definition of an International Declaration 10 3.2 Purposes and typical legal characteristics of the International 10 Declaration on Human Rights 3.2.1 Purposes 10 3.2.2 Typical legal characteristics ... Preamble of the Convention and their realization 4.3.1 21 23 The Body 23 4.3.2.1 The Body of the Convention and its realization 23 4.3.2.2 Remarks 26 a, Use of Grammar 26 a1 Modality 26 a2 Use of Active/...
- 6
- 634
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3
Ngày tải lên :
07/11/2012, 14:17
... is a provision of syntax that indicates the predication of an action, attitude, condition, or state other than that of a simple declaration of fact The modality of a grammatical form is the quality ... Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while these remain the basis of foreign language knowledge, discourse analysis can draw attention ... characteristics The International Declaration has following typical characteristics: - Each Declaration is drawn up based on the common consent of sides - Each Declaration is promulgated and adopted...
- 41
- 839
- 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4
Ngày tải lên :
07/11/2012, 14:17
... (c) Make higher education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessible to all children; ... vocational education, make them available and accessible to every child, and take appropriate measures such as the introduction of free education and offering financial assistance in case of ... equal protection of the law All are entitled to equal protection against any discrimination in violation of this Declaration and against any incitement to such discrimination Article Everyone has...
- 28
- 611
- 0
18 Selection plan for marketing team of risingstar s213 touch phone. How to build a winning team to successfully accomplish the project
Ngày tải lên :
03/04/2013, 12:11
... work and team work Finally, the task of evaluation work is to offer insightful analysis of options, so the characteristics which are suitable to this work of the team are strategic and discerning ... separate works which are planning, research, implementation, control and evaluation The characteristics of candidates who apply for team have to meet the characteristic of these works Firstly, the ... most popular law is equal opportunities and discrimination legislation In labor law of Vietnam, there is one chapter about “Particular regulations for female labor” which affirm clearly that people...
- 12
- 505
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... gồm tỉnh Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - ... “Cần Thơ gạo trắng nước trong”, “Gạo Cần Đước, nước Đồng Nai”, “Cơm Nai, R a; cá Rí, Rang” hay: “Ai miệt Tháp Mười, Cá tôm sẵn bắt, l a trời sẵn ăn ” (ca dao) v.v Trong Gia Đònh thành thông chí ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh...
- 137
- 853
- 0