a set of beans can use a network bean to connect to the network
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... nước trong”, “Gạo Cần Đước, nước Đồng Nai”, “Cơm Nai, R a; cá Rí, Rang” hay: “Ai miệt Tháp Mười, Cá tôm sẵn bắt, l a trời sẵn ăn ” (ca dao) v.v Trong Gia Đònh thành thông chí (GĐTTC) có đoạn:...
- 137
- 853
- 0
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
Ngày tải lên :
12/02/2014, 12:20
... calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner et al (2008) report the same participants, ... follow a GFD (Mihailidi, Paspalaki, Katakis, & Evangeliou, 2003) The risk of cancer decreases to the same as a person without CD after a GFD has been followed for to years (Coeliac UK, 2007) In addition ... bias? Use of valid and reliable paper and pencil measures a Sub-total Results Confounding variables controlled Generalisable results? Sub-total Total score Fabiani et al (1996) Fabiani et al (2000)...
- 171
- 709
- 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
Ngày tải lên :
18/02/2014, 16:20
... from the RNase A deamidation samples of Fig Deamidation at an individual residue of a specific product causes a Da increase in any fragment ion containing that residue The average mass gain of N-terminal ... on the molecular mass value of HAD was measured; instead of an adduct increase, or no change, the value had unexpectedly decreased from 22 417.0 Da to 22 413.2 Da, a loss of Da MS ⁄ MS of these ... YjbV fragment peaks The ‘) 20 ’ after the molecular mass value signifies that the main component ion of the most abundant isotopic peak contains 20 13C atoms and has this mass value of identification...
- 13
- 572
- 0
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
Ngày tải lên :
20/02/2014, 16:20
... in such a way that line crossings are avoided when connecting clusters As we can see, the dissimilarities among the top 30 associations to palm are all in the upper half of the scale and not ... decided to use the hierarchical clustering algorithm readily available in the MATLAB (MATrix LABoratory) programming language After some testing with various similarity functions and linkage types, ... words that are in the middle of the frequency range Figures to are based on the association lists for the words palm and poach Given that our term/context matrices are very sparse with each of their...
- 4
- 536
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
Ngày tải lên :
20/02/2014, 23:20
... cloned the cDNA of each A single amino acid (aa) substitution was confirmed to affect the thermal stabilities of vertebrate DNases I and, furthermore, one of the postulated mechanisms whereby thermal ... snakes and Japanese white rabbits were acquired, maintained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH, USA; revised 1985) Analytical methods DNase ... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose...
- 8
- 500
- 0
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot
Ngày tải lên :
06/03/2014, 21:20
... from the end of the previous financial year • records of statutory payments made, particularly on staff salaries • details of all assets The auditor may also ask to see: • a list of accruals – ... Fundamentals of NGO Management of the organisation’s finances at a fixed point in time – usually at the end of its financial year All assets are added and all liabilities subtracted to compute the ... organisation The statement usually says that, in the auditor’s opinion, the accounts are an accurate and honest statement of the organisation’s financial dealings and situation for the financial...
- 76
- 577
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... al A B C D other Statistical analysis (Student’s t-test) between the MR-1R values and the sum of the values of the omcA– and the omcB– mutants revealed that there is no statistically significant...
- 11
- 731
- 0
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
Ngày tải lên :
08/03/2014, 04:22
... Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability to reduce the dimensionality of a ... clusters are much more salient Also, widely and rural are well within the adjective cluster The comparison of the two dendrograms indicates that the SVD was capable of making appropriate generalizations ... our algorithms (SVD and clustering), we decided to restrict the number of rows to a vocabulary appropriate for evaluation purposes Since we are not aware of any standard vocabulary previously used...
- 4
- 433
- 0
A further contribution to the study of the mortuary customs of the North American Indians docx
Ngày tải lên :
08/03/2014, 13:20
... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... Indians he learned that tradition among the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, known as Karkhayahouchak Last year the captain was in the ... ceases, at the end of the year, they have high mass said for the benefit of the soul of the departed; after this they again appear upon the arena of their wild sports and continue to be gay and happy...
- 108
- 604
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
Ngày tải lên :
08/03/2014, 18:20
... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... consists of the stream of segments and a stream of stressesS: pangupangu Lexical lookup is complicated due to the fact that the surface string can differ from the underlying representation of the...
- 8
- 522
- 0
Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt
Ngày tải lên :
16/03/2014, 19:20
... only As regards the second aim, the TCj which accompany a current word may reveal that it could be a possible indicator of a main clause, or subordinate clause, or a phrase If such is the case, an ... is associated with four designators: Its clause number (C), A Status Flag (v) to indicate whether the predicate of the clause has or has not occurred, Its phrase number (P), and A Backward Flag ... it, and (3) the most suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the...
- 18
- 701
- 0
The road to reality a complete guide to the laws of the universe penrose, roger
Ngày tải lên :
17/03/2014, 14:53
... equivalent, in a speciWed sense, to each of the other members xviii Preface To mathematicians (at least to most of them, as far as I can make out), mathematics is not just a cultural activity that ... control the behaviour of the world and whatever their relations might be to mathematical truth This realization that the key to the understanding of Nature lay within an unassailable mathematics was ... in the time of Pythagoras What about the geometrical theorems that the Pythagoreans had obtained using their procedures of mathematical proof? They too have a clear validity today, but now there...
- 1.1K
- 542
- 4
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
Ngày tải lên :
23/03/2014, 14:20
... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... amusing and have a nice ring to them As a matter of fact, it turns out that the name Eatalian is actually used by at least one real Italian restaurant located in Los Angeles, CA3 For the same set of ... name The three “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing...
- 9
- 518
- 0
A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx
Ngày tải lên :
24/03/2014, 05:20
... Cornell and the secretaries that take care of the paperwork and negotiate the grand bureaucracies of the academic world, Douglas Milton, Judy Wilson, Deb Hatfield, Kacey Bray, Larissa Vygran, and ... gate above the oxide For the case of the GaAs/AlGaAs heterojunction, researchers at Bell Labs had the clever idea of introducing impurity atoms far enough away from the interface such that they ... electrically contacted suspended beam and a nearby gate electrode A voltage Vg, applied to this capacitor induces a charge q = CgVg onto the beam where Cg is the capacitance of the beam to the gate electrode...
- 140
- 510
- 0
LUẬN VĂN " A THESIS SUBMITTED TO THE GRADUATE SCHOOL OF NATURAL AND APPLIED SCIENCES OF MIDDLE EAST TECHNICAL UNIVERSITY " pot
Ngày tải lên :
29/03/2014, 11:20
... to the same anneal The glass first relaxed into the supercooled liquid (relaxed) state and crystallized with further isothermal annealing The regions marked as A- D indicate: (A) the heating of ... stable it is against the thermal treatments that may present in the practical applications The aim of this study in general was to investigate the solidification and crystallization behaviour of ... 2.3.3 The Use of Phase Diagrams in Evaluating the GFA When designing new bulk metallic glasses, it is a usual practice to use the binary and ternary phase diagrams of the constituent elements to...
- 140
- 552
- 0