a schematic diagram of the level of complexity from genome to the proteome 33

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Ngày tải lên : 12/09/2015, 11:08

... 8-oxo-hydrodeoxyguanosine Alanine aminotransferase Asparate aminotransferase Area under curve Carbonate radical anion Chromatin Immunoprecipitation Database for Annotation, Visualization and Integrated Discovery ... applications (Azad et al., 2006, Diamond et al., 2006, Hanash, 2003) 32 Figure 10 A schematic diagram of the level of complexity from genome to the proteome The increase in complexity of biological molecules ... label-free mass-spectrometry-based proteomics and (iii) and protein-chipbased arrays There are advantages and disadvantages to both platforms and they are listed in Table Due to the numerous facets of...

226
1.8K
0

Báo cáo khoa học: Deﬁciency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Ngày tải lên : 05/03/2014, 23:20

... heavy loading with fat The reticulin stain is a classical histopathological marker for the identiﬁcation of hepatic architecture and structural damage within the liver parenchyma Therefore, the ... mice A B C D revealed increased levels of steatosis, as demonstrated by the existence of a large number of lipid droplets within the vast majority of the examined hepatocytes Steatosis was diffuse ... containing a targeted replacement of the mouse apoE gene for the human apoE3 gene), we have shown that, in addition to its role in the maintenance of plasma lipid homeostasis, apoE plays a central...

11
544
0

Báo cáo hóa học: " Exploring the molecular mechanisms underlying the potentiation of exogenous growth hormone on alcohol-induced fatty liver diseases in mice" ppt

Ngày tải lên : 18/06/2014, 16:20

... those of ACC Cyp 4A1 , a downstream target of PPARa, was assessed as a marker of PPARa activation in vivo [33] These results indicate that exogenous GH1 therapy restores hepatic AMPK and PPARa activities, ... receptor (PPAR)-g and PPAR -a coactivator; PPARa: peroxisome proliferator activated receptor -a; Raav: recombinant adeno-associated virus; rAAV2/1, recombinant Qin and Tian Journal of Translational ... signaling cascades, including the hepatic SIRT1-AMPK and PPARa-AMPK signaling pathways GH may offer a novel and promising therapeutic target to treat ALFD in humans Abbreviations ACC: acetyl-CoA carboxylase;...

15
392
0

Báo cáo hóa học: " The Acute Liver Injury in Mice Caused by Nano-Anatase TiO2" docx

Ngày tải lên : 22/06/2014, 00:20

... GCGGAAAAGTCTGCACAAGG, mcrpr:GGAGATAGCACAAAGTCCCACAT, 153 bp; mmiff: CCATGCCTATGTTCATCGTGA, mmifr: ATCGTTCGTGCCGCTAAAAG, 167 bp; m actin f:GAGACCTTCAACACCCCAGC, m actin r: ATGTCACGCACGAT TTCCC, 263 bp All ... Preparation of DNA Samples from Mouse Liver The DNA was extracted from the liver and puriﬁed as described by the manual of DNA kits (Takara company), A2 60 /A2 80 ([1.8) indicated that the DNA was ... that higher dose nanoTiO2 (25 and 80 nm) increased the ratio of alanine aminotransferase to aspartate aminotransferase, the activity of lactate dehydrogenase and the liver weight, and caused the...

11
429
0

báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

Ngày tải lên : 11/08/2014, 00:23

... TTCAGAACC-3’ (291 bp), Alb S:5’-TCAACGTCAGAGCAGAGAAGC-3’, A: 5’-AGACTGCCTTGTGTGGAAGACT-3’, (145), AFP S: 5’-GTGAAACAGACTT CCTGGTCCT -3’, A: 5’-GCC CACAGACCATGAAACAAG-3’(bp148) RT-PCR was used to ... non-human primates Blood 2003, 101:2999-3001 Sato Y, Araki H, Kato J, Nakamura K, Kawano Y, Kobune M, Sato T, Miyanishi K, Takayama T, Takahashi M, Takimoto R, Iyama S, Matsunaga T, Ohtani S, Matsuura ... Biochemical parameters Serum was collected to analyze alanine aminotransferase (ALT), aspartate aminotransferase (AST), and Alb Assays were carried out at Lister Metropolis Laboratory, Chennai, India...

11
404
0

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine ﬁbrosarcoma L929 cells doc

Ngày tải lên : 18/02/2014, 13:20

... mode of type II programmed cell death, autophagy plays a major role in the degradation and recycling of intracellular materials [5] Macroautophagy, the most universal form of autophagy, is the ... Nishimaki K, Yamagata K, Katsura K, Katayama Y, Asoh S & Ohta S (2007) Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals Nat Med 13, 688–694 Nathan C ... mitochondrial apoptotic pathway In particular, Bax translocation from the cytosol into the mitochondria was reported to promote cytochrome c release from the mitochondria [19] In the present...

16
547
0

Arsenic immobilization by calcium arsenic precipitates in lime treated soils

Ngày tải lên : 15/03/2014, 23:48

... Bothe and Brown (1999) evaluated the formation of Ca–As precipitates at CayAs molar ratios that ranged from 1.5:1 to 2.5:1 The prepared slurry samples were then aged and periodically shaken at ... at a CayAs molar ratio of 1:1, but decreased significantly to 1.5 mgyl at a CayAs molar ratio of 4:1 (Table 2) Arsenic (V) immobilization was more pronounced at CayAs molar ratios greater than ... of 1.5:1, 2:1 and 2.5:1 increased, when compared to formation peaks at the same CayAs molar ratios at days This observation correlates to As concentration results at the same molar ratios (Tables...

15
320
0

Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc

Ngày tải lên : 16/03/2014, 04:20

... and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS84, 5¢-ACATATGTCATGCTCTGAGGACTGG GTT-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ... forward primer 5¢-CTCGAGACAATACAATTGTCCAGG-3¢, and reverse primer 5¢-ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢, and the PCR product was cloned into pBSK+ vector using the SmaI restriction site, and then ... of 2–3 days using the commonly available equipment in an average biochemical laboratory CD69NG70 was therefore selected as the best candidate for the stable and easily available form of soluble...

18
400
0

Nonalcoholic fatty liver disease in children living in the obeseogenic society doc

Ngày tải lên : 22/03/2014, 10:20

... NAFLD are asymptomatic.[28] Occasionally patients may complain of mild right upper quadrant abdominal pain, fatigue and malaise Most patients are diagnosed after the detection of high serum aminotransferase ... Y, Furusaka A, Miyahara T Diagnosis of NASH using delayed parenchymal imaging of contrast ultrasound Hepatol Res 2005 ;33: 97-99 72 Ziol M, Handra-Luca A, Kettaneh A, Christidis C, Mal F, Kazemi ... Tuzun A, et al Metformin in the treatment of patients with non-alcoholic steatohepatitis Aliment Pharmacol Ther 2004;19:537-544 94 Duseja A, Murlidharan R, Bhansali A, Sharma S, Das A, Das R, et al...

10
316
0

The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

Ngày tải lên : 22/03/2014, 10:20

... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... intervals thereafter Laboratory evaluation included liver biochemistries (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase ... normal laboratory values considering the normal range for the specific age and sex in each individual case {Includes the normal laboratory values for boys and girls for the age range of our patient...

7
487
0

Liver disease in children - Dr. Ahmed Al-Sarkhy, MD, MHSc, FAAP, FRCPC potx

Ngày tải lên : 28/03/2014, 09:20

... leukemia, lymphoma, and neuroblastoma • Primary liver tumors: Hepatoblastoma, hepatocarcinoma, and hemangioendothelioma • Presentation: hepatomegaly or abdominal distension or mass • Serum alpha-fetoprotein ... and AST) • In hepatocellular disease, the serum levels of GGT and AP not rise to the same degree as the aminotransferases Causes of liver disease in neonates & infants Causes of liver disease ... elevation of aminotransferases (often very high) and a variable degree of hyperbilirubinemia (mainly conjugated) Serum gamma globulin concentrations are elevated in nearly all patients AP and GGT values...

45
316
0

Autoimmune Liver Disease in Children potx

Ngày tải lên : 28/03/2014, 11:20

... a dose of prednisolone is required to maintain normal transaminases, azathioprine is added at a starting dose of 0.5 mg/kg/day which, in the absence of signs of toxicity, is increased up to a ... withdrawal was accomplished after a median treatment duration of 3.2 years (range, to 11 years), and remission was sustained in all for to 13 years The remaining children relapsed between and 15 ... experience, the drug was able to resolve laboratory abnormalities in of 12 children who did not tolerate or respond to azathioprine In others, it reduced serum aminotransferase levels to a degree that allowed...

5
345
0

Identification of antibacterial species in plasma treated liquids

Ngày tải lên : 18/05/2014, 20:35

... [2] These results lead to the assumption that the inactivating effect of the plasma treatment is mainly mediated by the liquid phase But which species caused this effect? Therefore the plasma/gas ... AS23 and variable wave length and conductivity detectors As eluent 4.5 mM disodium carbonate and 0.8 mM sodium hydrogencarbonat was used The flow was 0.25 ml ⋅ min-1 For data analyzing the software ... plasma treatment time [min] Fig 1: Inactivation kinetics of E coli as a result of plasma treatment of bacteria-containing sodium chloride (NaCl) solution ( ) as well as addition to E coli of...

4
302
0

báo cáo hóa học:" Mycophenolate pharmacokinetics and pharmacodynamics in belatacept treated renal allograft recipients – a pilot study" doc

Ngày tải lên : 18/06/2014, 15:20

... haematological parameters were performed according to standard methods at the clinical laboratory To evaluate the variability of IMPDH activity and gene expression without influence of medication ... significantly the first weeks after transplantation Plasma concentrations of albumin, total bilirubin, and ALAT were stable throughout the study period Data analysis and statistics Results of the ... doses ranging from 0.75 to 1.5 g MMF twice a day Several strategies have been suggested to individualize MPA therapy and improve the clinical outcome after transplantation The area under the MPA concentration...

14
532
0

Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx

Ngày tải lên : 18/06/2014, 16:20

... regulate pulmonary metastasis of mammary carcinomas by enhancing protumor properties of macrophages Cancer Cell 2009, 16(2):91-102 48 Mantovani A, Sica A, Allavena P, Garlanda C, Locati M: Tumor-associated ... ratio, and linear-by-linear association, as appropriate The cumulative survival time was computed using the Kaplan-Meier method and compared by the log-rank test Univariate and multivariate analyses ... Sugita J, Ohtani H, Mizoi T, Saito K, Shiiba K, Sasaki I, Matsuno S, Yagita H, Miyazawa M, Nagura H: Close association between Fas ligand (FasL; CD95L)- positive tumor-associated macrophages and apoptotic...

9
828
0

Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

Ngày tải lên : 18/06/2014, 16:20

... signaling [35] L-Asparaginase is an enzyme that catalyzes the hydrolysis of L-asparagine to L-aspartic acid and is used as part of the curative combination chemotherapy regimen for the treatment ... rapamycin treated animals were weighed at months (at the start of rapamycin treatment), and again at the time of euthanasia at ~12 months (see Additional File 3) All mice were euthanized at approximately ... rapamycin levels at the Clinical Laboratory at Children’s Hospital Boston (Boston, Massachusetts) The range of detection is 0.5 to 100 ng/ml of rapamycin Statistical analyses GraphPad Prism software...

18
611
0

Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot

Ngày tải lên : 18/06/2014, 16:20

... free kappa, one IgG/lambda from free lambda) One developed a double IgG/kappa from a single IgG/kappa, and two patients had complete change of paraprotein (one from IgA/kappa to IgG kappa, and ... responsible for the conception, design, and acquisition of data, analysis and interpretation of data, writing and approval of the manuscript Competing interests The author declares that they have no competing ... thalidomide/dexamethasone will be used instead of VAD Finally, DAPK methylation and oligoclonal reconstitution as potential adverse and favorable risk factors in myeloma warrants further validation with larger...

7
489
0

Báo cáo sinh học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" ppt

Ngày tải lên : 18/06/2014, 18:20

... translational levels (Fig 2) Total mRNAs were extracted %39 $ from the L1-transfected KCs and reverse-transcribed into cDNA using a reverse transcription kit (Promega, Australia) The cDNAs were analyzed ... association of the HPV life cycle with the differentiation state of its host cell is demonstrated by the restriction of late gene transcription and amplification of viral DNA to suprabasal epithelial ... treatment was separated by SDS-PAGE and blotted onto PVDF membrane The blots were probed with either anti-HPV L1 monoclonal antibody (BD PharMingen, Australia) or anti-involucrin polyclonal antibody...

6
394
0

Báo cáo hóa học: " Complexity of VTA DA neural activities in response to PFC transection in nicotine treated rats" pdf

Ngày tải lên : 19/06/2014, 08:20

... Our analysis indicates that the LZ estimators and entropy are useful tools for the characterization of the dynamical changes in VTA DA neuronal activity As demonstrated in our analysis, such changes ... recorded VTA DA neurons firing and analyzed the data using the advanced nonlinear dynamical analysis method based on the Lempel-Ziv (LZ) estimator Traditional analysis methods of neuronal firing activity ... domain was assigned a symbol, and the total number of unique symbols formed the alphabet of the sequence Since the data was composed of a series of action potentials that form the response of the...

8
403
0

báo cáo hóa học: " Focal glial activation coincides with increased BACE1 activation and precedes amyloid plaque deposition in APP[V717I] transgenic mice" pptx

Ngày tải lên : 19/06/2014, 22:20

... 5'-CCTGTGTAATGAAAGACGGC-3' and IL-1β reverse 5'-AAGGGA GCTCCTTCACA TGC-3'; GAPDH forward 5'-TCACCAGGGCTGCCATTTGC-3' and GAPDH reverse 5'-GACTCCACGACATACTCAGC-3'; IL-6 forward 5'- CAGAAA CCGCTATGAAGT ... exhibit also many inflammatory parameters ascribed to the AD pathology The early and focal neuro-inflammatory changes are demonstrated here to be parallelled closely by upregulated neuronal BACE1 ... can be hypothesized, that irregardeless of higher levels of inflammatory mediators present at 16 month, it is possible that (i) the total spectrum of proinflammatory and antiinflammatory mediators...

12
216
0