0

a room with a view quotes and page numbers

báo cáo khoa học:

báo cáo khoa học: "Citrobacter freundii infection after acute necrotizing pancreatitis in a patient with a pancreatic pseudocyst: a case report" docx

Báo cáo khoa học

... case of AP associated with brucellosis was reported in a 56-year-old patient with a seven-day history of fever,generalized myalgia and arthralgia, lower back pain,anorexia, and sweating. He ... treatment our patient progressedsatisfactorily. A week after starting the treatment, he feltwell and the abdominal pain gradually decreased. With the diagnosis of an acute necrotizing pancreatitis ... sponta-neouslyand,ifuntreated,theprognosisforapatientisalmost invariably death. Currently, two differentapproaches can be considered for primary drainage of a pancreatic pseudocyst: surgical and percutaneous.Appropriate antibiotic...
  • 4
  • 284
  • 0
Báo cáo y học:

Báo cáo y học: " The natural history of West Nile virus infection presenting with West Nile virus meningoencephalitis in a man with a prolonged illness: a case report" doc

Báo cáo khoa học

... intensity within the basalganglia and thalami. A West Nile virus titer was positive, and serial brain magnetic resonance imaging scansshowed resolving abnormalities that paralleled his neurological ... positive (acute and convalescent phase). A brain MRI scan (Figure 1C)obtained on day 21 revealed resolving inflammatorychanges in the basal ganglia and thalamus. Six weekslater he was fully oriented ... time, place, and person and did not articulate any complaints. Another brain MRIscan (Figure 1D) showed resolving basal ganglia and t ha-lamus edema with persistent hyperintense changes inboth...
  • 4
  • 310
  • 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Báo cáo khoa học

... DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 random-ized oligonucleotides in the center, i.e. CTGTCAGTGATGCATATGAACGAATN10AATCAACGACATTAGGATCCTTAGC was synthesized. A 100 ng sample of ... 701–713.15 Prabakaran P, An J, Gromiha M, Selvaraj S, UedairaH, Kono H & Sarai A (2001) Thermodynamic databasefor protein-nucleic acid interactions (ProNIT). Bioinfor-matics 17, 1027–1034.16 ... furtherconfirmed using the method of Gill and von Hippel [18].EMSATwo 16 bp fragments, EREwt (5Â-CATAAGAGCCGCCACT-3Â) and DREwt (5Â-ATACTACCGACATGAG-3Â)(for DNA base sequence and position numbering ofDREwt,...
  • 10
  • 464
  • 1
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo khoa học

... Ac-2124Alexander S. Shashkov1, Larisa N. Kosmachevskaya2, Galina M. Streshinskaya2, Lyudmila I. Evtushenko3,Olga V. Bueva3, Viktor A. Denisenko4, Irina B. Naumova2 and Erko Stackebrandt51N.D. ... rRNA gene wasamplified by PCR using prokaryotic 16S rDNA universalprimers 27f (5Â-AGAGTTTGATCCTGGCTCAG-3Â )and 1522r (5Â-AAGGAGGTGATCCARCCGCA-3Â) and puri-ed as described [8]. 16S rDNA was sequenced ... J.S. & Matthysse, A. G. (1997) Attachment ofAgrobacterium tumefaciens to carrot cells and Arabidopsis woundsites is correlated with the presence of a cell-associated, acidicpolysaccharide....
  • 6
  • 561
  • 0
báo cáo hóa học:

báo cáo hóa học: " The health-related quality of life in rheumatoid arthritis, ankylosing spondylitis, and psoriatic arthritis: a comparison with a selected sample of healthy people" potx

Hóa học - Dầu khí

... a measurefor disease activity and for radiographic damage. The Dis-ease Activity Score (DAS) [23] was used to evaluate diseaseactivity in patients with RA and peripheral PsA and theBath Ankylosing ... a visual analogscale (VAS) [23]. Disease activity in patients with AS and axial PsA was measured with the BASDAI [24]. The BAS-DAI consists of 6 VAS relating to major symptoms relevantto AS: ... toundergo a complete medical history, a careful clinicalexamination and radiological evaluation, 799 (71.3%)patients (469 with RA, 164 with SA, 65 with axial PsA and 101 with peripheral PsA) accepted...
  • 12
  • 466
  • 0
Báo cáo y học:

Báo cáo y học: "Attenuation of murine antigen-induced arthritis by treatment with a decoy oligodeoxynucleotide inhibiting signal transducer and activator of transcription-1 (STAT-1)" ppt

Báo cáo khoa học

... STAT-3, 5'-tca ctt ggg tgg aaa agg ac-3' and 5'-tgg tcg cat cca tgatct ta-3' (PCR product size 129 bp); CD40, 5'-ccc tgg gac ttcatg gta aa-3' and 5'-gca cac ... 5'-gac cac agt cca tgc cat cac tgc-3' and 5'-atg accttg ccc aca gcc ttg g-3' (PCR product size 137 bp); β-actin,5'-cca cag ctg aga ggg aaa tc-3' and 5'-tct cca ggg ... Sugiura T, TanakaM, Nakagawa M, Ichida H, Takagi K, Higami-Ohsako S, et al.:Amplification of the synovial inflammatory response throughactivation of mitogen-activated protein kinases and nuclearfactor...
  • 13
  • 449
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Bayesian estimation of dispersion parameters with a reduced animal model including polygenic and QTL effects" pot

Báo cáo khoa học

... of variation for ui and ’Yare relatively large and indicate that a posteriori knowledge on these parametersremains small, while estimates for oe and h2 are accurate. ... dispersion parameters,which is an advantageous property in Bayesian analysis !16!.In this paper, we present MCMC algorithms that allow Bayesian linkage analysis with a RAM. We ... random walk approach in which candidate y is drawnfrom a distribution centred around the current value x. To ensure that all sampledparameters are within the parameter...
  • 23
  • 295
  • 0
Báo cáo y học:

Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf

Báo cáo khoa học

... Torr). Thepatient received heart transplantation 20 weeks after BVAD implantation and was discharged from ICU 3 weeksafter transplantation.An increase in pulmonary vascular resistance in patients ... cardiopul-monary bypass and after LVAD activation [12,13]. Alter-natively, manual occlusion of the pulmonary arteryshortly before activatio n of the LVAD by the surgeon and transesophageal echocardiography ... therapeutic anticoagulation the resi-dual embo li diminished and pulmonary vascular resis-tance was measured at 184 dyneãs/cm5 with activatedassist device and 160 dyneãs/cm5 with deactivated assistdevice.Heart...
  • 4
  • 379
  • 0
báo cáo khoa học:

báo cáo khoa học: "A patient with amyotrophic lateral sclerosis and atypical clinical and electrodiagnostic features: a case report" pptx

Báo cáo khoa học

... diagnostic evaluation and treatment trials. conception and design as well analysis and interpretation of data. MAF and YP made substantial contributions to the acquisition of the data. Acknowledgements ... formattedPDF and full text (HTML) versions will be made available soon. A patient with amyotrophic lateral sclerosis and atypical clinical and electrodiagnostic features: a case reportJournal of Medical ... of a chronic axonal neuropathy with active Wallerian degeneration and remyelination without evidence of inflammation. The patient was treated with plasmapheresis (equivalent of one plasma volume...
  • 16
  • 273
  • 0
báo cáo khoa học:

báo cáo khoa học: " Using Mitrofanoff’s principle and Monti’s technique as a surgical option for bladder augmentation with a continent stoma: a case report" pps

Báo cáo khoa học

... thick, and the appendix was t oo short to beused directly and reach the skin at the right iliac fossa.Another relevant factor is that the navel’s skin, naturallyalready through the abdominal wall, ... in patients with a largeamount of subcutaneous tissue because channel lengthis required to reach the skin and the appendix that isanastomosed at the bladder wall with a nonrefluxinganastomosis.ConclusionThe ... AJC and ACPM performed the literaturereview. RBR wrote the discussion and literature review. HJS discussed thecase and revised the article. All authors have read and approved the finalmanuscript.Competing...
  • 3
  • 247
  • 0
What To Do If Trapped In A Lift With A Dentist

What To Do If Trapped In A Lift With A Dentist

Tài liệu khác

... othershistoryis a corpseleave it aloneit teaches us nothingexcept how to repeat past mistakesagain and again and againWARWarwhat is it good for?Reinvigorating depressed economies and winning ... human race have long?We haven't evolvedin the last 40,000 yearsPerhaps that explainsall our confusions and fearsStill fighting tribal battlesinternecine strife and hateOutdated racial ... needed the carrots for a stew and that I only had 3 carrots anyway which wouldn't go far among between 31 and 107 rabbits and would in all probability lead tosome rabbit on rabbit internecine...
  • 34
  • 515
  • 0

Xem thêm