0

a review and a new approach about ysz solid oxide electrolyte deposition direct on lsm porous substrate by spray pyrolysis

Báo cáo y học:

Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps

Báo cáo khoa học

... The phasor analysis based upon the Daysimeter data captures the association between the natural and continuously varying stimuli and responses Conversely, caged animals have many fewer options ... own activity-rest patterns Original data are also presented for two groups of rats, one placed on a 12L:12D pattern of light and dark and the other placed on a 12L:12D pattern of light and dark ... nurses, one day-shift nurse (Figure 6a) and one rotating-shift nurse (6b) and two example rats, a rat exposed to a regular 12L:12D pattern of light and dark (6c) and a "jet-lagged" rat exposed to a...
  • 14
  • 522
  • 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

Khoa học xã hội

... Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives A contrastive analysis with their Vietnamese equivalents (Graduation paper submitted ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make ... contrast, as it related to adjectives, is largely a semantic one, though as we have seen it also has syntactic implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander...
  • 44
  • 1,746
  • 7
Partnering: A New Approach to Sexual and Reproductive Health doc

Partnering: A New Approach to Sexual and Reproductive Health doc

Sức khỏe phụ nữ

... Family Health International ECO Economic Co-operation Organisation FLACSO Facultad Latino Americana de Ciencias Sociales G/PHN Government/Population, Health and Nutrition HHRAA Health and Human ... 162 List of Acronyms AIDSCAP AIDS Control and Prevention Project APHA American Public Health Association APPROPOP/PF Appui au Programme de Population/Planification Familiale ARH/SH Adolescent ... Population (IUSSP) Buenos Aires, Argentina, May 1998 (International) H Male Participation in Reproductive Health: New Paradigms AVSC International and International Planned Parenthood Federation/Western...
  • 196
  • 505
  • 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học

... 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed ... immunoprecipitation of CatE, and (L) endosomal fraction after immunoprecipitation of CatE Subcellular fractions were separated by SDS ⁄ PAGE (50 lg total protein per lane) on a 12% separating gel and transferred ... The Authors Journal compilation ª 2007 FEBS N Zaidi et al Parallel detection of CatE and CatD activity TAPA and specific catalytic activities of CatE and CatD were determined fluorimetrically by...
  • 12
  • 645
  • 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

Tự động hóa

... adsorption conformation, and that the adsorbed layer of PDADMAC would have substantially lower water content due to formation of a flat and rigid adsorbed layer The QCM-D and SPR are good complementary ... surfaces have enabled studies on the adsorption and adhesion phenomena and on the molecular level interactions between materials by sophisticated techniques, like SPR, QCM-D, and AFM, which all ... 1980) Cationic poly(acrylamides) (C-PAM) are prepared by radical co-polymerization of an acrylamide monomer with a cationic charge carrying comonomer (Fig 8) The polymers can be prepared in ranges...
  • 89
  • 701
  • 1
Báo cáo toán học:

Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt

Toán học

... components, storage time of the sediment, and presence or absence of fish Furthermore, the water content, the capacity of exchangeable cations, the organic matter and additional variables are ... biochemical markers (7ethoxyresorufin-O-deethylase, glutathione-S-transferase and catalase activity, lipid peroxidation), gene expression analyses (quantitative real-time RT-PCR), determination of ... Risk assessment of contaminated sediments in river basins–theoretical considerations and pragmatic approach J Environ Monit 2007, 9:943-52 Hollert H, Dürr M, Haag I, Wölz J, Hilscherova K, Blaha...
  • 5
  • 435
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A New Approach to q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials" pdf

Hóa học - Dầu khí

... polynomials,” in ¸ ¨ Proceedings of the 8th International Conference of Numerical Analysis and Applied Mathematics (ICNAAM ’10), AIP, Rhodes, Greece, March 2010 M Acıkgoz and Y Simsek, A new generating ... numbers and q-Bernstein polynomials We also consider the generalized q-Bernoulli polynomials attached to Dirichlet’s character χ and have their generating function We obtain distribution relations ... function of q-Bernstein-type polynomials and their ¸ ¸ ¸ ¨ interpolation function,” Abstract and Applied Analysis, vol 2010, Article ID 769095, 12 pages, 2010 M Acıkgoz and Y Simsek, On multiple...
  • 9
  • 442
  • 0
Sectors and Styles - A New Approach to Outperforming the Market docx

Sectors and Styles - A New Approach to Outperforming the Market docx

Quản trị kinh doanh

... George and Andrea Fulop, Emily and Len Brizzi, Gino and Donna Albertario, Vahan Janjigian, Annette and Clint Welch, Don Horenstein, Mark Wachs, John Mihale, Mark and Roberta Aaronson, Rocco Papandrea, ... Marshall, and everyone else at the Stamford Society, also many thanks to you for years of help and support To John Kirby and the staff and board at the Market Technicians Association, I always ... action and economic performance, and the markets’ take on both It is a rich and robust way to analyze all the important aspects of both the real economy (the G and E part) and the financial economy...
  • 275
  • 706
  • 0
capital structure and firm performance a new approach to testing agency theory and an application to the banking industry

capital structure and firm performance a new approach to testing agency theory and an application to the banking industry

Quản trị kinh doanh

... Estimation: Ownership Sample and Full Sample Means and Standard Deviations for 1990-95 All financial variables measured in 1000's of constant 1994 dollars Prices of financial assets and liabilities ... these additional banks are owner managed rather than professionally managed, and therefore not provide a good laboratory for testing the agency costs of the separation of ownership and management.19 ... holdings, and institutional holdings Our application to data from the banking industry is advantageous because of the abundance of quality data available on firms in this industry In particular, we have...
  • 38
  • 561
  • 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

Tiến sĩ

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
  • 144
  • 306
  • 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

Tổng hợp

... BX51) at 400X magnification - 42 - Chapter Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied ... fibroplasia and granulation tissue formation, fibroblasts grow and form a new, provisional extracellular matrix (ECM) by collagen and fibronectin deposition In epithelialization, epithelial cells ... such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability NO’s role as a neurotransmitter in the CNS and a neurally-mediated...
  • 80
  • 424
  • 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Kỹ năng đọc tiếng Anh

... comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline ... (Scheme 2) was reduced immediately with zinc in absolute ethanol15 to give alkene 10 Careful acetylation of 10 with acetic anhydride and DMAP in dichloromethane gave the acetate 11 contaminated with ... terminal double bond in 19 was then subjected to hydroboration–oxidation to afford alcohol 20 Oxidation of 20 with tetra-n-propylammonium perruthenate (TPAP)–NMO21 gave the aldehyde 21 Addition...
  • 3
  • 547
  • 0
The Republic of Beliefs A New Approach to Law and Economics

The Republic of Beliefs A New Approach to Law and Economics

Tổng hợp

... manage to change expectations, it can have a binding effect and give the appearance of an iron fist controlling society However, all said and done, this is always an appearance, because the law ... Bhattacharya and Mishra (1989), Basu, Basu and Cordella (2015) For some recent analysis of this problem of bribery and the motivation of the law enforcer, see Abbink, Dasgupta, Gangadharan and ... have called our approach thus far more accurately the focal point approach with neo-classical features.’ What I am moving on to now is a recognition that human preferences are malleable and can...
  • 55
  • 514
  • 0
A New Approach to Quantum Theory

A New Approach to Quantum Theory

Khoa học tự nhiên

... there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by the field that it radiated, then ... finding a quantum mechanical description applicable to systems which in their classical analogue are expressible by a principle of least action, and not necessarily by Hamiltonian equations of motion.” ... quantum mechanical analogue, namely, the transformation matrix (qt |qT ) This matrix connects a representation with the variables q diagonal at time T with a representation having the q’s diagonal...
  • 142
  • 574
  • 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Cao đẳng - Đại học

... implementing a transformation: the Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor public management ... impose a transformational change into their organizations (Slavin and Woodard 2006, 23): We close with a caution and a challenge Transformation has many elements, and the failure of any one can doom ... the private sector; local, regional, and global social service organizations and other nongovernmental and faith-based organizations; and private citizens, working alone and in groups The new model...
  • 288
  • 2,415
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx

Báo cáo khoa học

... time-consuming phase in the operation word segmentation We have evaluated our approach on two monolingual corpora of English and Hebrew documents and, additionally, on one bilingual corpora comprising ... operators: mating, crossover, and mutation In mating, a pair of “parent” solutions is randomly selected, and a new solution is created using crossover and mutation, that are the most important part ... Summarization Natural Language Processing, John Benjamins Publishing Company Rada Mihalcea 2005 Language independent extractive summarization In AAAI’05: Proceedings of the 20th national conference on...
  • 10
  • 598
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Question Answering as Question-Biased Term Extraction: A New Approach toward Multilingual QA" doc

Báo cáo khoa học

... evaluation Automatic evaluation consists of exact matching and partial matching Partial matching is useful for absorbing the variation in extraction range A partial match is judged correct if a system’s ... question analysis, answer candidate extraction, and answer selection modules were independently built from a QA dataset and an NE dataset, which is limited to eight named entities, such as PERSON and ... Della Pietra: A Maximum Entropy Approach to Natural Language Processing, Computational Linguistics, Vol 22, No 1, pp 39–71 (1996) 221 Abdessamad Echihabi and Daniel Marcu: A NoisyChannel Approach...
  • 8
  • 357
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

Báo cáo khoa học

... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... IPA Lexicon of Basic Japanese Nouns Japan Electronic Dictionary Research Institute Ltd 1995 EDR Electronic Dictionary Specifications Guide Sadao Kurohashi and Makoto Nagao 1994 A syntactic analysis ... examining these analysis results, we can conclude that the dictionary-based understanding approach can provide us with much richer information than the conventional classification-based approaches 5.3...
  • 8
  • 553
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học

... T{P-J~IR~ MA~.n all MAJLIf d P~ all ~UA ~ liB! PIO jI M@AJUf| WJA ~UA (b) Figure 2a is the phonological representation for the sentence: ngarrka.ngku.ka marlu marna.kurra luwa.rnu ngarni.nja.kurra 'The ... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... morphological parsing A number of extensions can easily be made and a number of design improvements are necessary Acknowledgments We would like to thank Mary Laughren and Ken Hale for their advice on Warlpiri...
  • 8
  • 522
  • 0

Xem thêm