a quest for socio solidarity economy and partnership in sustainable urban development
A quest for identity returnee filmmakers and postwar shanghai cinema, 1945 1949
... Shanghai Library and Peking University Library I want to thank my graduate classmates Fan Xue, Fan Rui, Ji Xing, Wang Yue and Ma Jilian, for providing a stimulating and fun environment in which ... Dr Nicolai Volland for his continuous support of my Master study and research, for reading my proposals, making comments and revising my thesis drafts, with his patience, motivation and immense ... dissertation I am grateful to the secretaries for assisting me in different ways During my writing and fieldwork, I received many help form Central Library of National University of Singapore, Shanghai...
- 93
- 479
- 0
Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt
... Definition Lying Lying passively Standing Standing passively Locomotion Moving, walking or running Running Constant running under human harassment Eating Animal inside the feeding area ingesting feed ... reindeer (Rangifer tarandus tarandus) Acta Physiol Scand 2000, 170, 145-151 Moen AN: Seasonal changes in heart rates, activity, metabolism, and forage intake of white-tailed deer J Wildl Manage ... BW) and the pulse rate during anaesthesia was increased with adrenalin i.v (10 mg/ml; 50 µg/kg BW) Antisedan (Orion, Finland, mg/ml; 200 µg/kg BW) was used as the antidote for the anaesthetic and...
- 10
- 239
- 0
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx
... the transgenic plants The average GUS activity was obtained from at least five independent transformants, and each assay was repeated three times RNA extraction For RNA isolation, the plant tissues ... F, Santa-Maria GE & Rodriguez-Navarro A (2000) Cloning of Arabidopsis and barley cDNA encoding HAK potassium transporters in root and shoot cells Physiol Plant 109, 34–43 Shabala L, Cuin TA, Newman ... RNA helicase acts as a negative regulator in K+ deprivation signaling pathways in Arabidopsis However, the precise mechanism of the regulation between AtHELPS and K+ deprivation in plants remains...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... Data analysis All spectra were treated with in- house software working in a MATLAB environment (MATLAB 6, Mathworks Inc., Natick, USA) Spectra were separated in a training set constituted of 48 samples ... (Fig 1), including several areas in lipid and in nucleic acid regions, and one area associated with proteins (amide II) Training set spectra were used for model building in LDA The model was tested...
- 6
- 555
- 0
Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc
... society As shown in (Sable and Akcay, 2010) green represents danger in Malaysia, envy in Belgium, love and happiness in Japan; red is associated with luck in China and Denmark, but with bad luck in ... Affective forms for english words (anew): Instruction manual and affective ranking Chris Callison-Burch 2009 Fast, cheap, and creative: evaluating translation quality using amazon’s mechanical turk In ... evokes and define a set of concepts associated with that color For Task 2, we showed a particular facial feature and a swatch in a particular color, and asked 50 workers to name the color and describe...
- 9
- 527
- 0
Báo cáo khoa học: "A Procedure for Multi-Class Discrimination and some Linguistic Applications" pptx
... unseen instances, since all instances (e.g., kintypes in kinship analysis) are as a rule available at the outset 10 The aphasics discrimination task can be classed as type (ii): the discrimination ... contrast of language pairs Following the other alternative path, and allowing 'missing' as a distinct value, will result in the successful discrimination of most language pairs Greek and Serbian ... Two classes C1 and C2 are contrasted by a Boolean or nominal feature if the instances of C1 and the instances of C2 not share a value • Two classes C1 and C2 are contrasted by a numeric feature...
- 7
- 364
- 0
A Quest for Global Peace ppt
... dealt a devastating blow by the war My father was in the transportation business and he had horses and horse-drawn wagons Most of his customers were in Finland As soon as the war began, the German ... increased safety standards Technologies also have made obtaining food, clothing and shelter less of a daily chore Progress in communication and information has given more people access to cultural achievements ... global peace-04 ch01.fm Page Friday, August 18, 2006 5:08 PM A QUEST FOR GLOBAL PEACE by the Toda Institute for Global Peace and Policy Research, which I founded, and to thank you again for rushing...
- 175
- 514
- 0
A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx
... Alternatives for Jet Engine Intermediate Maintenance, Mahyar A Amouzegar, Lionel A Galway, and Amanda Geller (MR-1431-AF) This report evaluates the manner in which Jet Engine Intermediate Maintenance ... Theater Airlift Planning and Execution Organizational and Doctrine Shortfalls 43 AS-IS Theater Airlift Planning and Execution Training Shortfalls 46 AS-IS Theater Airlift Planning and ... Element Air National Guard Air and Space Operations Center Area of responsibility Aerial port of debarkation Aerial port of embarkation U.S Army, Central Command ATO ATOC CAOC Air tasking order Air...
- 151
- 453
- 0
Báo cáo khoa học: "a Toolkit for Distributed Perceptron Training and Prediction with MapReduce" doc
... classification using the perceptron algorithm Machine Learning, 37(3):277–296 John Lafferty, Andrew Mccallum, and Fernando Pereira 2001 John lafferty and andrew mccallum and fernando pereira In Proceedings ... the same features The implementation is in Java, and we interface with the Hadoop cluster via the native Java API It can be easily adapted to a wide range of NLP tasks Incorporating new features ... (Collins, 2002) is an online learning algorithm that processes training instances one at a time during each training epoch In sequence labeling tasks, the algorithm predicts a sequence of labels...
- 5
- 433
- 0
báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc
... Integration, application and practice objectives are one area where practica and capstones (theses or projects) can serve a critical catch-all role, in much the same way as qualifying exams for ... strategic planning approach Assess and align mission The newly created Department of Health Behavior and Administration was charged with administering two existing graduate degree programmes (Master ... constraints Faculty & committee plans & actions Figure Hierarchy of mutually reinforcing strategic and action plans Hierarchy of mutually reinforcing strategic and action plans http://www.human-resources-health.com/content/7/1/71...
- 10
- 577
- 0
Báo cáo hóa học: " Research Article A Framework for System-Level Modeling and Simulation of Embedded Systems Architectures" ppt
... additional information for YML objects Certain simulators may require certain information on parameter values For example, Sesame ’s architecture simulator needs to read an array of execution latencies ... distinct models for them According to the Y-chart approach, an application model—derived from a target application domain—describes the functional behavior of an application in an architecture-independent ... application domain in mind—defines architecture resources and captures their performance constraints Finally, an explicit mapping step maps an application model onto an architecture model for cosimulation,...
- 11
- 400
- 0
ASTM A 53_SPECIFICATION FOR PIPE, STEEL, BLACK AND HOT-DIPPED, ZINC-COATED, WELDED AND SEAMLESS SA-53/SA-53M ppt
... purchaser, Type S and Type E pipe shall also be marked with the heat number In addition, the marking of seamless pipe shall include the information given in Table 25 Packaging and Package Marking ... smaller, measured as a gap between the lowest point 178 COPYRIGHT American Society of Mechanical Engineers Licensed by Information Handling Services Workmanship, Finish and Appearance PART A ... Table X3.1 for threading data For standardweight pipe NPS [DN 200] and larger and all sizes of extra-strong weight and double extra-strong weight, refer to Table X3.2 for threading data Threaded pipe...
- 28
- 701
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we ... transduction pathway is involved in the TNF-α-mediated increase in Cyp7b activity in human FLS Signaling pathways that mediate the effects of TNF-α include mitogen-activated protein kinases (MAPKs) and ... transcription factors in rheumatic disease Arthritis Rheum 1999, 42:609-621 Chang L, Karin M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and...
- 10
- 462
- 0
Báo cáo y học: "A pilot study on peritraumatic dissociation and coping styles as risk factors for posttraumatic stress, anxiety and depression in parents after their child''''s unexpected admission to a Pediatric Intensive Care Unit" ppt
... studies after cancer, and in general stress literature [11-13,26] Interestingly, avoidance coping strategy was not related to anxiety and depression, indicating that avoidance coping may pose increased ... passive and avoidance coping styles In addition, a set of informa- Page of (page number not for citation purposes) Child and Adolescent Psychiatry and Mental Health 2009, 3:33 tional materials ... identify parents at risk and intervene in an early stage to minimize chronic and pathologic mental health problems A next step is to replicate these findings in a larger sample of parents and explore...
- 9
- 315
- 0
microsoft access a primer for relational database design and use
... Contains all Data Tables PA Harris, Vanderbilt University Microsoft Access – Module Summary MS-Access is a powerful relational database program It has many integrated features and can be greatly ... available (packaged with MS-Office Premium) Easy to use (relative to other systems –Oracle may require one FTE to maintain the server as a database administrator and another FTE to serve as an ... type grants) PA Harris, Vanderbilt University What is in an MS-Access file - 1? Although the term “database” typically refers to a collection of related data tables, an Access database includes...
- 38
- 443
- 0
The food chemistry laboratory - a manual for experimental foods, dietetics, and food scientists
... Andreas M Papas Food Shelf Life Stability N .A Michael Eskin and David S Robinson Bread Staling Pavinee Chinachoti and Yael Vodovotz Interdisciplinary Food Safety Research Neal M Hooker and Elsa A ... Murano Automation for Food Engineering: Food Quality Quantization and Process Control Yanbo Huang, A Dale Whittaker, and Ronald E Lacey The Food Chemistr y Laboratory A Manual for Experimental ... Properties Handbook Shafiur Rahman Aseptic Processing and Packaging of Foods: Food Industry Perspectives Jarius David, V R Carlson, and Ralph Graves The Food Chemistry Laboratory: A Manual for Experimental...
- 134
- 409
- 0
A calculus for stochastic qos analysis and its application to conformance study
... the amount of trac users or neighboring domains are allowed to send for such a subscribed QoS level In this framework, all incoming ows must conform to a certain pre-determined SLA and conformance ... empty at time The system has the same input trac and a constant rate server Specically, let A (s, t) and Q (A, t, r) respectively denote the amount of trac arriving in the time interval [s, t) and ... the backlog, delay and burstiness bounds for a ow with an arrival curve after passing through a server oering a service curve As can be seen in Table 2.1, these deterministic QoS performance...
- 165
- 228
- 0
A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse
... human beings interact in an economy is beginning to be questioned, and instead concepts associated with evolutionary biology are starting to be promoted among certain leading academics Perhaps ... metaphor may start out as an explanatory device and facilitate understanding of complex and abstract issues, but gradually it may get absorbed into peoples way of thinking to such an extent that ... conceptualised as objects that move up and down, through lexis such as rising and falling, soaring and plummeting, edging up and slipping back 10 Lakoff and Johnson (1980:p.6) argue that human thought...
- 33
- 1,109
- 3
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al (2009) Automated immunoassay system for AFP-L3% using on-chip electrokinetic reaction and separation ... arguing for a common origin Nat Chem Biol 5, 244–250 16 Kuno A, Itakura Y, Toyoda M, Takahashi Y, Yamada M, Umezawa A & Hirabayashi J (2008) Development of a data-mining system for differential ... appearing in the dark gray area of the Venn diagram are thought to be relatively abundant in serum, and are primary candidates for further validation Glycoproteins found in the pale gray area are secondary...
- 11
- 854
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25