a qualitative approach to understanding ¡°new¡± poverty in the former soviet union

Chemical drug assisted gene transfer a sensible approach to improve transgene expression in the central nervous system

Chemical drug assisted gene transfer a sensible approach to improve transgene expression in the central nervous system

Ngày tải lên : 12/09/2015, 10:15
... these above studies indicate a novel approach to use HDAC inhibitors to enhance baculovirus-mediated gene therapy by increasing the expression of the transgene In addition, with their intrinsic anti-tumor ... compartment into the cytoplasm, and uptake of the DNA into the nucleus This multi-step process indicates that there are many factors affecting the transfection efficiency of PEI, including particle ... Saeki et al., 1993b) Chan et al first used cyclosporine, a PGP modulator, in combination with chemotherapy for in retinoblastoma patients and achieved the relapse-free rate as high as 90% (Chan...
  • 161
  • 418
  • 0
báo cáo khoa học: " ’It’s risky to walk in the city with syringes’: understanding access to HIV/AIDS services for injecting drug users in the former Soviet Union countries of Ukraine and Kyrgyzstan" ppt

báo cáo khoa học: " ’It’s risky to walk in the city with syringes’: understanding access to HIV/AIDS services for injecting drug users in the former Soviet Union countries of Ukraine and Kyrgyzstan" ppt

Ngày tải lên : 11/08/2014, 14:21
... study and analysis and interpretation of data AH contributed substantially to the analysis and interpretation of data All authors participated in manuscript writing and have read and approved the ... investigator triangulation approach was adopted: multiple researchers contributed to analysing the findings to reduce bias and enhance the internal validity of the synthesis The synthesis involved a ... explanatory insights into the problems of accessing HIV/AIDS services The aim was to develop a better understanding of the nature and complexity of factors that obstruct access rather than to measure...
  • 15
  • 477
  • 0
the mit press environmental justice and sustainability in the former soviet union jun 2009

the mit press environmental justice and sustainability in the former soviet union jun 2009

Ngày tải lên : 11/06/2014, 13:37
... recentralization of power and a failure to implement the laws Another key factor in creating and maintaining this situation is that, nearly twenty years after the breakup of the Soviet Union, ... Territories’’ to its original form, and the parks in the Altai were reinstated.21 Others have tried to protect land by declaring certain areas ‘‘sacred sites’’ (see CAFF 2004) At a seminar in the ... laws, unequal access to information about changes in laws and to the legislative process, bureaucratic protocols, and legal technicalities The state has used the law as a weapon against indigenous...
  • 306
  • 360
  • 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Ngày tải lên : 25/10/2012, 10:45
... Acta Veterinaria Scandinavica 2009, 51:36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the incidence ... that specific situation?' Data Analysis The qualitative analysis is based on a phenomenographic approach; that is a qualitative method to use empiric data (e.g., interview) to describe the variation ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis...
  • 10
  • 587
  • 0
Tài liệu Báo cáo khoa học: "A PRAGMATICBASED APPROACH TO UNDERSTANDING" pdf

Tài liệu Báo cáo khoa học: "A PRAGMATICBASED APPROACH TO UNDERSTANDING" pdf

Ngày tải lên : 21/02/2014, 20:20
... from a particular teacher, learning the material in a given text, and attendIng class will all reside at the same focus level within the expanded plan for earning credit in a course The action ... domain If as action is a member of a focus d o m a i n and that action is not the root action of another focus domain, then all the actions contalnad in the plan associated with the first action ... plan Note that the exlsting plan may contain constant instantiatlons in place of former variaOles A term fragment still associates with such constant terms A constant fragment can only associate...
  • 10
  • 446
  • 0
Báo cáo khoa học: "A Grammatical Approach to Understanding Textual Tables using Two-Dimensional SCFGs" docx

Báo cáo khoa học: "A Grammatical Approach to Understanding Textual Tables using Two-Dimensional SCFGs" docx

Ngày tải lên : 08/03/2014, 02:21
... twodimensional SCFG parsing model for table analysis which has several advantages over the ad hoc approaches First, the probabilistic grammar approach permits a cleaner encapsulation and generalization ... database manage- • Flat model: A table is interpreted as a database table in non-1NF normal relational model • Nested model: A table is interpreted as a database table in an object-relational model, ... layout of textual tables may be determined by its context as well as its language For instance, it is natural for an Arabic reader to read an Arabic table taking the rightmost column as the attribute...
  • 8
  • 482
  • 0
Báo cáo khoa học: A modelling approach to quantify dynamic crosstalk between the pheromone and the starvation pathway in baker’s yeast pot

Báo cáo khoa học: A modelling approach to quantify dynamic crosstalk between the pheromone and the starvation pathway in baker’s yeast pot

Ngày tải lên : 30/03/2014, 10:20
... velocities was incorporated into the model by increasing or decreasing kinetic parameters by a factor of 10 (see remarks to the model parameters in the Supplementary material) Due to the lack of knowledge ... crossactivation In the same paper it is demonstrated that the invasive growth pathway can also leak into the mating pathway However, activation of Fus3 by the filamentous growth pathway is weak and therefore ... knowledge about the wiring of the pheromone pathway and the filamentous growth pathway in yeast We concentrated on the main dynamic features and the interconnections between the two pathways and on a...
  • 14
  • 395
  • 0
Báo cáo khoa học: "A FLEXIBLE APPROACH TO COOPERATIVE RESPONSE GENERATION IN INFORMATION-SEEKING DIALOGUES" docx

Báo cáo khoa học: "A FLEXIBLE APPROACH TO COOPERATIVE RESPONSE GENERATION IN INFORMATION-SEEKING DIALOGUES" docx

Ngày tải lên : 31/03/2014, 06:20
... knowledge are goals and actions Actions can be elementary or complex and in the second case one or more plans (decompositions) can be associated with them All these plans share the same main effect Each ... specific information is available For exainple, a step of die action of getting information on a course plan is to talk with the curriculum advisor, that can be •specialized in different ways according ... validity; finally, those with a value unknown to both the user and the system, but that the user can verify by himself (e.g the availability of books in the library) Also constraints of the last...
  • 3
  • 304
  • 0
báo cáo khoa học: "A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach" ppt

báo cáo khoa học: "A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach" ppt

Ngày tải lên : 11/08/2014, 11:21
... Maruyama-Nakashita A, Nakabayashi K, Li W, Ogawa M, Yamauchi Y, Preston J, Aoki K, Kiba T, Takatsuto S, Fujioka S, Asami T, Nakano T, Kato H, Mizuno T, Sakakibara H, Yamaguchi S, Nambara E, Kamiya ... Kamiya Y, Takahashi H, Hirai MY, Sakurai T, Shinozaki K, Saito K, Yoshida S, Shimada Y: The AtGenExpress hormone and chemical treatment data set: experimental design, data evaluation, model data analysis ... Moriguchi R, Ikeda H, Takahashi H, Takahashi H, Fujii N, Guilfoyle TJ, Kanahama K, Kanayama Y: Expression analysis of the auxin efflux carrier family in tomato fruit development Planta 2010, 232(3):755-764...
  • 14
  • 204
  • 0
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

Ngày tải lên : 14/08/2014, 16:20
... TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TAGCCCACGACAGCCAAATAATAATGAATCATTTCATAAATAATGGGTTTAGGGGCTTATCGGGA Rn Mm Pt Hs Fr GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG ... TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGCGGA TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG ... GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG...
  • 18
  • 389
  • 0
Affordances of heritage environment a conservation approach to hanoi ancient quarter in vietnam 1

Affordances of heritage environment a conservation approach to hanoi ancient quarter in vietnam 1

Ngày tải lên : 14/09/2015, 08:39
... Heritage meanings: There are many definitions of heritage Traditionally, Heritage is a term that came to the fore in the 1970s in Europe, and its meaning increasingly was expanded in the 1980s and ... and the social situation Secondly, there is environmental information, which people can obtain from the landscape, livable place and plane surface at a certain time and in a certain space to enable ... communities are living in (M alacca, Penang, Taiping in M alaysia; Bhaktapur in Nepal; LiJiang- China and etc) With regard to the third category, conservation of culture involves intangible properties...
  • 238
  • 464
  • 0
Affordances of heritage environment a conservation approach to hanoi ancient quarter in vietnam 2

Affordances of heritage environment a conservation approach to hanoi ancient quarter in vietnam 2

Ngày tải lên : 14/09/2015, 08:39
... idea/ business Others Detached/ Attached objects a Is there any architectural objects as an integral part of the Quarter d If there is lacking architectural objects appropriate to ancient Quarter ... spaces a Is there any a sharing kitchen/ a place for cooking? b What are functions of the cooking spaces useful to you? food/ meal preparation for the family at a bounded area cook traditional ... event having the red book - The building was constructed by Chinese for opening restaurant and moved back China since 1979 After that, the building was managed by the State - Total population:...
  • 84
  • 336
  • 0
Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology

Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology

Ngày tải lên : 11/12/2016, 20:47
... methodology applied All the used data are obtained from DataStream The software package used to analyse the data is Matlab1 , a computational software package mainly used by engineers and econometricians ... have the same characteristics, defined by M.Sc thesis B Masselink, M.Sc 18 Data and methodology their mean and standard deviation as the historical data As mentioned before the data are obtained ... Meaning that by incorporating the specific crisis into an ALM approach, more risk is incorporated, according to the classical risk return trade off Table 4-1: Funding ratio characteristics VAR...
  • 54
  • 305
  • 0
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx

Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx

Ngày tải lên : 29/03/2014, 04:20
... extreme manifestation (and logical result) of the analytical approach, which may be said to be aiming at a maximum of abstraction with a minimum of meaning And it is meaning that man needs; and an understanding ... qualitatiue The analytical thinking approach already has the quantitative language of mathematics to describe its frndings; but the intuitive approach until now has had no generallyaccepted and comprehensive ... Astrological Association as the most valuable contribution to astrology during that year My main orientation in writing that section was to clarify various approaches to astrology and to reveal its practical...
  • 40
  • 539
  • 1
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_2 pdf

Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_2 pdf

Ngày tải lên : 29/03/2014, 04:20
... conclusions The ideal to look for in evaluating the elemental emphasis in a chart is at least some attunement to each element This results in the ability to achieve a balanced approach to living and the ... imagination if they rely too much on things as they are or as they appear to be This can lead to a narrowness ofoutlook, an addiction to routine and order, and a total lack ofability to deal ... planet since the beginning of time Astrologers call them the zodiacal signs and are mainly concerned with them in relation to the way they manifest in human beings as personality types All of the...
  • 59
  • 521
  • 2
Báo cáo toán học: "A Combinatorial Approach to Evaluation of Reliability of the Receiver Output for BPSK Modulation with Spatial Diversit" pot

Báo cáo toán học: "A Combinatorial Approach to Evaluation of Reliability of the Receiver Output for BPSK Modulation with Spatial Diversit" pot

Ngày tải lên : 07/08/2014, 13:21
... with the Young tableau a3 a5 a2 a2 T= a1 a1 a1 a4 is w(T ) = a3 a2 a1 a5 a2 a1 a1 a4 Note that applying the column insertion to the mirror image of a tableau word w(T ) yields the tableau T ... process, the box containing a number from any column of the ribbon in the classical numbering will be no further to the right in the tableau than any box containing another number from the same column ... us, therefore, start by introducing the reader to some aspects of the latter Modulating numerical signals means transforming them into wave forms Due to their importance in practice, modulation...
  • 31
  • 205
  • 0
Báo cáo y học: "A novel scheme to assess factors involved in the reproducibility of DNA-microarray data" pdf

Báo cáo y học: "A novel scheme to assess factors involved in the reproducibility of DNA-microarray data" pdf

Ngày tải lên : 14/08/2014, 14:21
... could obtain By mining the data from several validation datasets it was possible to determine which factors contribute to the variance in normalized DNA-microarray data The following factors were ... contains a self-hybridization The VSG interaction contains variances due to hybridization and sampling Some factors are confounded Due to the fact that in our DNA-microarray laboratory validation ... described in this paper proved to be satisfactory, while at same time a maximum amount of data was preserved One has to bear in mind that a significant part of the variance in our data is caused by varying...
  • 35
  • 274
  • 0
HOMEOWNERSHIP AND HOUSING FINANCE POLICY IN THE FORMER SOVIET BLOC COSTLY POPULISM pptx

HOMEOWNERSHIP AND HOUSING FINANCE POLICY IN THE FORMER SOVIET BLOC COSTLY POPULISM pptx

Ngày tải lên : 15/03/2014, 10:20
... rate on the balance set at the market rate (initially 36 percent), or shifting to a variable rate mortgage with a 15 percent initial interest rate Poland In 1990 the original interest rate was ... universal banks and intends to stimulate bank lending by creating a liquidity facility to purchase mortgages that banks originate that meet the facility’s standards At the same time, a smaller share ... fixed in the contract, in case of increased in ation the government often must raise the bonus to maintain the attractiveness of the system A positive feature of all housing-linked contract savings...
  • 236
  • 317
  • 0
Economic Implications Of Chronic Illness And Disability In Eastern Europe And The Former Soviet Union pptx

Economic Implications Of Chronic Illness And Disability In Eastern Europe And The Former Soviet Union pptx

Ngày tải lên : 28/03/2014, 23:20
... World Bank The series covers the following countries: Albania Armenia Azerbaijan Belarus Bosnia and Herzegovina Bulgaria Croatia Czech Republic Estonia FYR Macedonia Georgia Hungary Kazakhstan Kyrgyz ... employers to accommodate disabled workers and outlaw discrimination against the disabled in hiring, firing, and pay in the United States is argued to have a negative influence on the labor force participation ... waves in an attempt to single out causal relationships, and takes into account main individual and household characteristics—reveal that newly occurring disability leads to an eighthour decrease...
  • 156
  • 270
  • 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

Ngày tải lên : 18/03/2014, 02:20
... havaittiin, kun kitosaani adsorboitui pysyvästi selluloosamallipinnalle ilman elektrostaattisen attraktion vaikutusta Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ... Finland) The fibre preparation was the same as in Paper III, described above Thereafter, the fibres were disintegrated into microfibrillar material by mechanical treatment adapted from Chacraborty ... addition PDADMAC induced a sharp increase in frequency and a decrease in dissipation, indicating a reduction of the detected mass and an increase in elasticity of the surface Logically, the frequency...
  • 89
  • 701
  • 1

Xem thêm