a psychoanalytic approach informed by poststructuralism
RECENT DEVELOPMENTS IN MOBILE COMMUNICATIONS – A MULTIDISCIPLINARY APPROACH Edited by Juan pdf
... indicators were gathered from several web sites such as OECD regulatory database, ITU World Telecommunications Regulatory database, Privatization Barometer database and POLCOIII dataset Note that, ... Frank, Massy and Wind (1972) and Saporta (1976), the multiplicity of variables usable for demand segmentation has lead to an array of taxonomies A useful one is offered by Wedel and Kamakura ... Privatizations: The Spanish Experience International Review of Financial Analysis, Vol 16, No 4, p 367–389 Fink, Carsten; Mattoo, Aaditya; and Rathindran, Randeep An Assessment of Telecommunications...
- 284
- 327
- 0
Báo cáo y học: "Acute Complex Type A Dissection associated with peripheral malperfusion syndrome treated with a staged approach guided by lactate levels" ppt
... right axillary and bilateral common femoral approaches, a 150 mm covered stent graft (Medtronic, Santa Rosa, USA) was deployed into the thoracic aorta, distal to the left subclavian artery A further ... organ ischemia can be managed through revascularization grafts such as axillary- femoral bypass Endovascular stenting without entry closure for type A dissection has the risk of cardiac tamponade ... median sternotomy and cannulation via the previous right-axillary artery conduit, cardiopulmonary bypass was instituted and the patient was cooled to 22°C Antegrade cardioplegia and cerebral perfusion...
- 5
- 389
- 0
Tài liệu Báo cáo khoa học: "A PROBABILISTIC APPROACH TO GRAMMATICAL ANALYSIS OF WRITTEN ENGLISH BY COMPUTER" pot
... function so that, for instance, in fact is labelled as a prepositio'~aT-~rase rather than as an adverbial phrase No attempt is made to show any paraphrase relationships Putative deleted or a 161 either ... WORD TAGGED CORPUS -~ T-TAG A~ IGNFLENT (PARTIAL PARSE) -~ BRACKET CLOSING AND T-TAG SELECTION - ~ CONSTITUENT ANALYSIS Phrasal ,nd clausal categories and boundaries are assigned on the basis of ... a wh-word beginning with a wh-ever word Comparative adverb phrase with a measured gradable R l~v Rr Hx HV" Grammatical forms of the verb HAVE, (have, had (past tense), h a v e , ha-~-Vpas-~participle...
- 7
- 529
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
- 11
- 731
- 0
preparation of fe2o3 submicro - flowers by a hydrothermal approach
... through a hydrothermal method using Span80 or L113B as a soft template [17] Wan et al have proposed a soft-template-assisted hydrothermal route to prepare single crystal nanorods with an average diameter ... characterized by uniform size and shape with a high specific surface area, exhibited superior electrochemical activity, with an initial discharge capacity of 905.7 mAh/g and reversible capacity ... After the reaction, the autoclave was cooled down naturally The resulting product was separated and collected by centrifugation, washed with ethanol and distilled water to ensure total removal...
- 6
- 382
- 0
A new approach to Internet banking by Matthew Johnson pdf
... including banks, can also be used by an attacker Combined with VoIP and war-dialling techniques an attacker can automatically try hundreds of numbers and use an automated system which, like banks, ... to be lax about changing the default passwords Because the administration interface is nearly always web-based, this opens up some attacks As Stamm et al [30] have shown, if Javascript can be ... the attack tree considering the Ma a as the attacker It assumes all the normal parties in the transaction (the merchant, the customer and the bank) are trusted and that attacks come from a third...
- 113
- 471
- 0
TOWARDS A COMPREHENSIVE APPROACH OF SEXUAL AND REPRODUCTIVE RIGHTS AND NEEDS OF WOMEN DISPLACED BY WAR AND ARMED CONFLICT pptx
... comprehensive approach of SRH still constitutes a real challenge for donors, international humanitarian agencies, national authorities, national and international non-governmental organizations, and community ... Identification - - Coordination - Stakeholders involved in humanitarian aid for the displaced population (donors, international organizations, national and local authorities, international and national ... or by not eating enough foods rich in iron and folic acid Some diseases can also cause anaemia by destroying the red blood cells Anaemia in pregnancy: Anaemia in pregnancy is defined as a haemoglobin...
- 41
- 470
- 0
Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot
... IgG/kappa from a single IgG/kappa, and two patients had complete change of paraprotein (one from IgA/kappa to IgG kappa, and one from IgD/lambda to IgG/kappa) Statistical analysis OS was defined as ... Garc a- Lara a J, Martínez-Martínez R, Hernández-Garc a MT, Carrera D, Besalduch J, de Arriba F, Ribera JM, Escoda L, Hernández-Ruiz B, Garc a- Frade J, Rivas-González C, Alegre A, Bladé J, San ... Spicka I, Petrucci MT, Palumbo A, Samoilova OS, Dmoszynska A, Abdulkadyrov KM, Schots R, Jiang B, Mateos MV, Anderson KC, Esseltine DL, Liu K, Cakana A, van de Velde H, Richardson PG: VISTA Trial...
- 7
- 489
- 0
Báo cáo y học: " Management of deep neck infection by a transnasal approach: a case report" ppsx
... patient did not have airway obstruction To date, only a small number of patients have been treated by the transnasal endoscopic approach Endoscopic approaches have a number of important advantages ... children: a new approach to diagnosis and treatment Laryngoscope 1997, 107:1627-1634 Nicolai P, Lombardi D, Berlucchi M, Farina D, Zanetti D: Drainage of retro-parapharyngeal abscess: an additional ... endoscopic approach under local anesthesia week after CT scanning A vertical incision, cm in length, was made in the lateral epipharyngeal wall The opening was enlarged by removing some inflamed mucosa...
- 5
- 358
- 0
Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx
... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens ... regulated This regulation is mediated by proteins such as cell surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that ... prepared the paper CRW, HHL, YW, YSS, LYH and YSZ participated in developing the hypothesis and collaborated in writing and reviewing of the article All authors read and approved the final manuscript...
- 4
- 287
- 0
Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc
... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens ... regulated This regulation is mediated by proteins such as cell surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that ... prepared the paper CRW, HHL, YW, YSS, LYH and YSZ participated in developing the hypothesis and collaborated in writing and reviewing of the article All authors read and approved the final manuscript...
- 4
- 271
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities for across-herd data analyses and, ... before analysing the data on national level Causal analysis of cow-level and herd-level risk factors for metritis at the national level based on Danish central data base files was performed by Bruun ... following situations in a herd (e.g scoring a cow and initiating a metritis treatment), would you please elaborate on that specific situation?' Data Analysis The qualitative analysis is based on a phenomenographic...
- 10
- 587
- 0
Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"
... further evaluated by a HCV RNA test HCV RNA can be measured either quantitatively or qualitatively, which can approach a low limit of detection of 50 IU/ml or 100 viral copies/ml as early as 1-2 ... Am J Gastroenterol 1998;93(1):44-8 29 Giannini E, Risso D, Botta F, et al Validity and clinical utility of the aspartate aminotransferase-alanine aminotransferase ratio in assessing disease severity ... level correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) >1 is a dependable marker for cirrhosis [28,29] Increased INR and thrombocytopenia...
- 6
- 532
- 0
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"
... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... normal transaminases have historically not been considered as candidates for HBV treatment based on the assumption that these patients usually have a slow progression and evidence that these patients ... response to LAM and ADV therapies are similar to those for IFN except that baseline HBV DNA may not be very important Individualization of HBV Treatment As summarized in Table and Figure 1, although...
- 7
- 541
- 0
A New Approach to Quantum Theory
... there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by the field that it radiated, then ... contact transformations,” which has an important quantum mechanical analogue, namely, the transformation matrix (qt |qT ) This matrix connects a representation with the variables q diagonal at ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal...
- 142
- 574
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...
- 44
- 1,745
- 7
a holistic approach in coastal management
... structural or reclamation works was proposed to avoid impact to the corals CAFEO 28 Hanoi, Vietnam (18-22nd Dec 2010) Coastal Management - Beach Rehabilitation At Pulau Tioman, Malaysia Figure7 - Layout ... - Beach Rehabilitation At Pulau Tioman, Malaysia ERE (2006), “Detailed Environmental Impact Assessment For Beach Rehabilitation Project At Tekek, Tioman Island, Malaysia”, Reports Prepared by ... of seasonal boat traffic, land availability, siltation deposition rates and anticipated frequencies of dredging Water Quality Study A detailed water quality study was carried out at the main rivers...
- 12
- 570
- 0
a decentralized approach for implementing identity management in cloud computing
... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach s accompanying high rate of false positives There are ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous ... calculating formula of TU S is: (1) n Ev is the evaluation of current trade When a normal trade happens, Evn is a positive number And on the contrary, Evn is a negative number, when an anomaly trade...
- 7
- 589
- 0
Enhancement of domestic wastewater treatment under long sewer line condition in a laboratory set-up by Aspergillus niger bioaugmentation
... phosphatase (alkaline, acid and phosphohydrolase), cellulase (α-glucosidase, β-galactosidase, α-mannosidase), esterase (C4 and lipase C8) and protease (leucine aminopeptidase) The enzymatic activities ... α-fructosidase α-mannosidase glucosaminidase β-glucosidase α-glucosidase β-galactosidase β-glucurosidase α-galactosidase Phosphohydrolase Acid phosphatase Chemotrypsine Trypsine Cystine aminopeptidase ... countries, water resource pollution will reach the critical level if alternative processes are not developed and adapted to actual scenario in treating wastewater Wastewater treatment in sewer line by...
- 7
- 609
- 0
Listening to Patients A Phenomenological Approach to Nursing Research and Practice
... role socialization, and cultural heritage are valued We are Christians and Jews, Appalachians and Easterners, Black and White, men and women, young and old, graduate students and faculty All contribute ... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter ... the man as a nurse and Ginger as a physician, whereas still other reactions identify the man as a nurse and Ginger as a patient You don't have to be a philosopher of language or a communications...
- 309
- 398
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25