a powerful tool for reverse ventricular remodeling

báo cáo khoa học: "Atomic force microscopy: a powerful tool for high-resolution imaging of spermatozoa" ppt

báo cáo khoa học: "Atomic force microscopy: a powerful tool for high-resolution imaging of spermatozoa" ppt

Ngày tải lên : 11/08/2014, 00:22
... E, Yanagida T: Dynein arms are oscillating force generators Nature 1998, 393:711-714 Sakakibara H, Kojima H, Sakai Y, Katayama E, Oiwa K: Inner-arm dynein c of Chlamydomonas flagella is a single-headed ... acrosome intact and acrosome-reacted human sperm heads [9] Structural changes of the hamster sperm head surface associated with maturation, capacitation and acrosome reaction has also been studied ... the area of medial sagittal plane of the anterior portions of acrosome-reacted sperm heads is approximately 40% less than those of intact heads Morphological alterations in spermatozoa leading...
  • 6
  • 363
  • 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Ngày tải lên : 26/10/2012, 09:48
... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... 84-90 Stathopoulos GP, Koutantos J, Vaslamatzis MM, Athanasiadis A, Papadopoulos G, Labrodimou G, Stathopoulos J, and Rigatos S Survival after cytotoxic chemotherapy in patients with advanced hormone-resistant...
  • 10
  • 408
  • 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Ngày tải lên : 31/10/2012, 14:59
... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...
  • 11
  • 715
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Ngày tải lên : 19/02/2014, 16:20
... degradation (–ajsajs) and a second influence through its autocatalytic feedback (+ajsbjs) through the same reaction, vs The latter influences cancel each other, again as all stoichiometries are ... they are not branched and correspond to any step between two substances in graphs such as Graph (1), i.e any path that involves a single chemical reaction One actual chemical reaction may effect a ... not have steady states on its border, all phase trajectories lead inward Steady states on the border are readily identified ([21] and an example below) That am be positive and (i < m) be negative...
  • 11
  • 638
  • 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

Ngày tải lên : 06/03/2014, 08:20
... interventions A New Tool for Scaling Impact 15 15 outcomes (such as smoking cessation) are achieved Foundations could act as payor via performance-based grants on projects that have large societal value, ... Collaboration with relevant government agencies will also be necessary to gain access to administrative data, such as Medicaid records Administrative data will allow evaluators to assess program ... risks, as well as financial and social returns, are properly articulated and managed They will require tools, such as a credit scorecard, that reflect an intermediary’s methodical and careful...
  • 36
  • 262
  • 0
Báo cáo khoa học: "A Debug Tool for Practical Grammar Development" doc

Báo cáo khoa học: "A Debug Tool for Practical Grammar Development" doc

Ngày tải lên : 08/03/2014, 04:22
... of Japan SIG Notes NL-127, pages 173–178, September In Japanese Takashi Miyata, Kazuma Takaoka, and Yuji Matsumoto 1999 Implementation of GUI debugger for unification-based grammar In Information ... prepositional phrases are annotated manually The tags not always specify the correct structures based on rental-XTAG (i.e., the grammar assumed by tags is different from rental-XTAG), so we prepared a ... pages 38–45 Koiti Hasida 2003 Global document annotation (GDA) available in http://www.i-content.org/GDA/ Hisao Imai, Yusuke Miyao, and Jun’ichi Tsujii 1998 GUI for an HPSG parser In Information...
  • 4
  • 360
  • 0
Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

Ngày tải lên : 16/03/2014, 01:20
... 101–103 2094 A V Antonov et al 33 Okuda S, Yamada T, Hamajima M, Itoh M, Katayama T, Bork P, Goto S & Kanehisa M (2008) KEGG atlas mapping for global analysis of metabolic pathways Nucleic Acids Res ... reactions that share the same compounds In general, a reaction consists of multiple reactant pairs, and the one that appears in a KEGG metabolic pathway is called a main pair To build a global ... bioinformatics to provide a statistically valid interpretation of compound lists produced experimentally Currently, several bioinformatics approaches are available for metabolomics Each approach...
  • 11
  • 401
  • 0
Báo cáo khoa học: "A Graphical Tool for GermaNet Development" ppt

Báo cáo khoa học: "A Graphical Tool for GermaNet Development" ppt

Ngày tải lên : 17/03/2014, 00:20
... well This would mean that the wordnet data for a given language would have to be stored in a relational database and that the tool itself can handle the language specific data structures of the ... displayed It is possible to edit the examples and frames associated with a lexical unit via the Examples and Frames tab Frames specify the syntactic valence of a lexical unit Each frame can have an ... frame can have an associated example that indicates a possible usage of the lexical unit for that particular frame The tab Examples and Frames is thus particularly geared towards the editing of...
  • 6
  • 349
  • 0
Báo cáo khoa học: "a Visual Tool for Validating Sense Annotations" docx

Báo cáo khoa học: "a Visual Tool for Validating Sense Annotations" docx

Ngày tải lên : 31/03/2014, 01:20
... Successes and Future Directions Philadelphia, PA Christiane Fellbaum, editor 1998 WordNet: an Electronic Lexical Database MIT Press Rada Mihalcea and Dan Moldovan 2001 Automatic generation of a coarse ... Navigli and Paola Velardi 2005 Structural semantic interconnections: a knowledge-based approach to word sense disambiguation IEEE Transactions on Pattern Analysis and Machine Intelligence (PAMI), ... of a sense choice, marked in orange based on the validation policy, is just a proposal and can freely modified by the validator, as explained hereafter Before starting the interface, the validator...
  • 4
  • 399
  • 0
the eq difference a powerful program for putting emotional intelligence to work

the eq difference a powerful program for putting emotional intelligence to work

Ngày tải lên : 03/06/2014, 01:01
... don’t always end up as successful as Jack—what’s different about Jack?) His father’s parting message was, “Always act as a gentleman.” These words, spoken decades ago, called Jack to develop a sense ... Washington D.C Special discounts on bulk quantities of AMACOM books are available to corporations, professional associations, and other organizations For details, contact Special Sales Department, ... Jones, Dave Kahle, Connie Komack, James Kinneer, Renita R Kinney, Joanne Koopman, Tom Kopler, Patty Kreamer, Pat Krivonak, Francine Lanar, Terri Logan, Bruce Mabee, G Marceau, Geraldine Markel,...
  • 299
  • 492
  • 0
turbocoach a powerful system for achieving breakthrough career success

turbocoach a powerful system for achieving breakthrough career success

Ngày tải lên : 03/06/2014, 01:28
... intentionally left blank TurboCoach A Powerful System for Achieving Breakthrough Career Success Brian Tracy and Campbell Fraser American Management Association New York • Atlanta • Brussels • Chicago • Mexico ... corporations, professional associations, and other organizations For details, contact Special Sales Department, AMACOM, a division of American Management Association, 1601 Broadway, New York, NY 10019 ... professional person should be sought Library of Congress Cataloging-in-Publication Data Tracy, Brian TurboCoach : a powerful system for achieving breakthrough career success / Brian Tracy and Campbell...
  • 223
  • 227
  • 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Ngày tải lên : 18/06/2014, 22:20
... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
  • 24
  • 604
  • 0
báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx

báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx

Ngày tải lên : 19/06/2014, 10:20
... Ladouceur M, Barbeau H: A treadmill apparatus and harness support for evaluation and rehabilitation of gait Arch Phys Med Rehabil 1995, 76:772-778 Kamel HK, Iqbal MA, Mogallapu R, Maas D, Hoffmann RG: ... and balance in a wide range of categories of patients The system allows natural mediolateral APAs to occur across a wide range of gravity-like loads, an important balance related stimulus that ... with a removable pin The wheel base of a regular hospital bed has been modified to hold a pneumatic force actuator, a flat friction free surface that supports a back pack frame with air bearings,...
  • 7
  • 475
  • 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt

Ngày tải lên : 29/06/2014, 09:20
... Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud and Jean Marie Razafimahenina Chapter Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier by Matlab/Simulink ... Balogh, Pavel Zỏskalický, S Chountasis, V.N Katsikis, D Pappas, Mohammed Z Al-Faiz, Abbas H Miry, Ramy Saad, Sebastian Hoyos, Samuel Palermo, Momoh-Jimoh E Salami, Ismaila B Tijani, Abdussamad ... Daniel Havelka, Christophe Batard, Frộdộric Poitiers, Christophe Millet, Nicolas Ginot, Jacques Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud, Jean Marie Razafimahenina, Ergin...
  • 534
  • 691
  • 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

Ngày tải lên : 29/06/2014, 09:20
... Prokop, Walid Hassairi, Moncef Bousselmi, Mohamed Abid, Carlos Valderrama, Moulay Tahar Lamchich, Nora Lachguer, Gaizka Almandoz, Gaizka Ugalde, Javier Poza, Ana Julia Escalada, Oriol Font-Bach, Antonio ... Software for Design and Analysis of Electrical Machines 161 Gaizka Almandoz, Gaizka Ugalde, Javier Poza and Ana Julia Escalada Section Telecommunication-Communication Systems 185 Chapter MATLAB as ... Jiménez, Lara del Val, Alberto Izquierdo, Juan J Villacorta, Myriam Codes, Farhad E Mahmood, Muhammad Ahsan, Tapio Saramäki, Prashant M Menghal, A Jaya Laxmi, Libor Pekař, Eva Kurečková, Roman Prokop,...
  • 324
  • 788
  • 0
Tài liệu mẫu phân tích IPA  Importance   performance analysis as a strategic tool for destination attractiveness an analysis of domestic

Tài liệu mẫu phân tích IPA Importance performance analysis as a strategic tool for destination attractiveness an analysis of domestic

Ngày tải lên : 01/08/2014, 10:25
... the mean importance and performance of destination attributes VIII Analysis and Discussion Table 1: Importance Performance Means Destination attributes Mean Beach Backwaters Ayurveda Mountains/hill ... their ways of living Aranmula is famous for its ‘metal mirror’ and boat race There are also institutions like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school for ... s c o m [39] Bindu Narayanan, Chandrasekharan Rajendran, Prakash Saia, L, Ram Gopalan,“Dimensions of service quality in tourism – an Indian perspective”, Total Quality Management, Vol 20, No...
  • 7
  • 874
  • 3
Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

Ngày tải lên : 07/08/2014, 18:21
... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM...
  • 7
  • 323
  • 0
Báo cáo khoa học: "Polyhedral representation of crown shape. A geometric tool for growth modelling" ppsx

Báo cáo khoa học: "Polyhedral representation of crown shape. A geometric tool for growth modelling" ppsx

Ngày tải lên : 08/08/2014, 19:21
... surface area) and measurements of tree growth (annual basal area and bole volume increments) A strong allometric relation exists between the measured tree basal area and calculated crown surface ... Margolis HA (1992) Factors affecting the relationship between sapwood area and leaf area of balsam fir Can J For Res 22, 1684-1693 Dong PH, Laar A Van, Kramer H (1989) [A model for research on forest ... branches attached to the secondary branches From these data, we calculated the Cartesian coordinates (x,y,z) of the origin and tip of each growth unit A stem analysis gave basal area (at breast height)...
  • 10
  • 345
  • 0
Báo cáo y học: "A web tool for finding gene candidates associated with experimentally induced arthritis in the rat" docx

Báo cáo y học: "A web tool for finding gene candidates associated with experimentally induced arthritis in the rat" docx

Ngày tải lên : 09/08/2014, 06:22
... rheumatoid arthritis Clin Exp Immunol 1993, 91:207-213 28 Yu S, Nakashima N, Xu BH, Matsuda T, Izumihara A, Sunahara N, Nakamura T, Tsukano M, Matsuyama T: Pathological significance of elevated ... Boyd AW, Wicks IP: Characterization of a human synovial cell antigen: VCAM-1 and inflammatory arthritis Immunol Cell Biol 2001, 79:419-428 19 Gonzalez-Alvaro I, Ortiz AM, Garcia-Vicuna R, Balsa A, ... this approach also manages to predict several candidate genes that are already established in the literature Thus, the CGC application is a helpful tool for finding candidate genes associated...
  • 8
  • 415
  • 0

Xem thêm