a new technique of buried absorbable wound closure associated with excellent cosmesis for wounds under tension
Báo cáo y học: : A new classification of HLA-DRB1 alleles differentiates predisposing and protective alleles for autoantibody production in rheumatoid arthritis" pptx
Ngày tải lên :
09/08/2014, 10:20
... first amino acids at positions 70 and 71 (boldface): S1 for ARAA and ERAA, S2 for KRAA, S3 for RRAA (divided into S3P for QRRAA and S3D for DRRAA according to position 70), and X for all non-RAA ... ARAA and ERAA, S2 for KRAA, S3 for RRAA, and X for all non-RAA patterns Since an aspartic acid (D) at position 70 was reported to be protective against RA susceptibility in comparison with a ... an HLADRB1 allelic protective effect for ACPA production in RA In these studies, HLA-DRB1*03 was associated with ACPAnegative RA and decreased titers of ACPAs, even in the presence of an SE allele...
- 8
- 691
- 0
Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc
Ngày tải lên :
09/08/2014, 07:20
... Pharmaceuticals, Osaka, Japan) was used for saturation (30 at 37°C) After two washes, sera (diluted 1/50) were added and the plates were incubated for 12 hours at 4°C After washing, alkaline phosphatase (AP)-conjugated ... the prevalence in these populations of patients with autoantibody related forms of RA, in particular the prevalence of those who have pathogenic autoantibodies that directly interact with FcγRs ... consent was obtained from all participants Blood samples were collected from 187 Japanese patients with RA (mean age 46 ± 17 years; 33 females; mean disease duration 12.9 years [range 1–46 years])...
- 6
- 414
- 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx
Ngày tải lên :
21/06/2014, 20:20
... limitations has led to a situation where damage is continuing and has placed many important items at risk This has created an urgent need for a technique that can capture the information in each of ... 125–135, 1997 E Prados, F Camilli, and O Faugeras, A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol ... negatives of a large collection before the damage causes a complete and irretrievable loss of information 2.1 Restoration Approaches The primary approach to slowing the deterioration of photographic...
- 13
- 569
- 0
Báo cáo y học: "A new technique for bedside placement of enteral feeding tubes: a prospective cohort study" pps
Ngày tải lên :
14/08/2014, 07:21
... study and participated in the analysis of data GE, DS, IF, MS and NW participated in the analysis and interpretation of data IF and GE revised the manuscript NW conceived the study and participated ... examined the use of a new endoscope enabling the attending ICU physician to place jejunal feeding tubes transnasally independent of a special endoscopy team Transnasal endoscopy for the placement ... [22] Another study reported a success rate of 78% with spiral nasojejunal tubes compared with a rate of 14% with straight tubes, however, with a very low rate of correct positions [23] Self-advancing...
- 5
- 430
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
- 137
- 853
- 0
A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process
Ngày tải lên :
05/09/2013, 08:40
... NaAc conc vs the “E Time” Figure 5: Comparison of CO2 profile of TAD supernatant and NaAc additions Table 2: TAD supernatant VFAs estimation based on “E Time” approach Estimated VFAs Analytical ... supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation, ... on the basis of tests using the same batch of sludge sample Acetate and VFAs concentrations were verified using a Hewlett-Packard® 588 0A gas chromatograph, equipped with a flame ionization detector...
- 6
- 405
- 0
Tài liệu Activity 1.1: Designing a New Type of Motorcycle doc
Ngày tải lên :
17/01/2014, 09:20
... design of current motorcycles You need to collect information to make an informed decision about the type of motorcycle that will attract new riders After you collect and analyze the information, ... designers at a motorcycle factory Next, identify a spokesperson who can present the group’s ideas in a class discussion Brainstorm about your answers and present them in any format that will communicate ... Indicate at least two questions that you can ask each source Different sources may require different types of questions Assume that the three sources you identified have provided all of the information...
- 4
- 304
- 0
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
Ngày tải lên :
18/02/2014, 00:20
... group an action or reaction among actors that is triggered by an CATALYSIS outside agent a very small amount of catalytic agent can facilitate a very large-scale reaction If we think of tools and ... go hand-in-hand, posing a choice at every juncture, a choice that arises because of a basic dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One and the Many ... was informed by the insights of an expert group, including: Lada Adamic, Information Dynamics Lab, Hewlett-Packard Laboratories Gene Becker, Strategic Programs Manager, Hewlett-Packard Laboratories...
- 67
- 893
- 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt
Ngày tải lên :
18/02/2014, 14:20
... ions, Na+ ⁄ K+-ATPase also acts as a signal transducer [44,45] In this respect, studies carried out with ouabain, a natural blocker of the Na+ pump and an inhibitor of palytoxin action, have provided ... Na,K-ATPase alpha subunit Proc Natl Acad Sci USA 91, 2965–2969 50 Cantiello HF (1997) Changes in actin filament organization regulate Na+,K(+)-ATPase activity Role of actin phosphorylation Ann NY Acad ... Oku N, Sata NU, Matsunaga S, Uchida H & Fusetani N (2004) Identification of palytoxin as a principle which causes morphological changes in rat 3Y1 cells in the zoanthid Palythoa aff margaritae Toxicon...
- 8
- 691
- 0
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf
Ngày tải lên :
18/02/2014, 21:20
... being embedded across all corporate and functional strategies and business plans People and performance Performance gaps are also apparent with regard to the capabilities and assessment of employees ... and in collaboration with others Many challenges and discontinuities lie ahead 34 A new era of sustainability is far from guaranteed and will require both leadership and urgency As Paul Polman, ... metrics to measure and communicate sustainability performance New concepts of value and performance that are embedded at both the organizational and individual levels • Devise mechanisms to measure...
- 36
- 556
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
Ngày tải lên :
19/02/2014, 00:20
... rotating anode generator (Rigaku, Tokyo, Japan) equipped with an image plate detector (Mar Research, Hamburg, Germany) These data were integrated with the mosflm package [23] and scaled with scala ... favored and favored regions of the Ramachandran ˚ plot and r.m.s.d values for bond and angle of 0.005 A and 1.37 ° as shown in Table References Table Data collection and refinement statistics of ... Val-Ser-Ala-ArgflMet-Ala-Pro and Phe-Thr-Phe-ArgflSer-Ala-Arg for PAI-1 and PCI, respectively [6] By contrast, the reactive site loops of a1 -antichymotrypsin and heparin cofactor II contain leucine instead of arginine...
- 13
- 588
- 0
Life and Physical Sciences Research for a New Era of Space Exploration docx
Ngày tải lên :
05/03/2014, 11:21
... Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant ... Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant viii AERONAUTICS AND SPACE ENGINEERING BOARD RAYMOND ... there are substantial problems with translational research efforts in space exploration A critical advantage of the ISS is that it provides a platform for research programs that can, in fact,...
- 47
- 606
- 0
Research Program of the Partnership for a New Generation of Vehicles doc
Ngày tải lên :
06/03/2014, 15:20
... Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National Laboratory, and the Department of ... SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering viii Acknowledgments ... desirable characteristics of fuel oxygenates was undertaken Finally, a more detailed chemical characterization of the PM was incorporated into the data analysis procedure The initial phase of this...
- 134
- 466
- 0
A New Database of Financial Reforms pot
Ngày tải lên :
06/03/2014, 19:20
... Lithuania Spain Azerbaijan Finland Madagascar Sri Lanka Bangladesh France Malaysia Sweden Belarus Georgia Mexico Switzerland Belgium Germany Morocco Taiwan Bolivia Ghana Mozambique Tanzania Brazil ... Financial Reform Database Country name Albania Ecuador Kenya Russia Algeria Egypt Korea Senegal Argentina El Salvador Kyrgyz Republic Singapore Australia Estonia Latvia South Africa Austria Ethiopia Lithuania ... (Contains financial reform information for the U.S., Japan, Australia, New Zealand, Korea, Taiwan, the Philippines, Thailand, Indonesia, China, Singapore, Malaysia and Canada) De Brouwer, Gordon and...
- 30
- 1.1K
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
Ngày tải lên :
07/03/2014, 02:20
... signals at the plasma membrane that lead to the translocation of nuclear FADD to the cytoplasm In a process that depends on a positive feedback loop involving caspase8 activation, cytoplasmic FADD ... localization during apoptotic signaling await further investigation What is the biological function of nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation ... stained with a mAb against human CD95 (DX2; BD Pharmingen) on ice Cells were then fixed with 2% paraformaldehyde for analysis by flow cytometry Alternatively, cells were stimulated with Alexa 647-labeled...
- 10
- 483
- 0
A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot
Ngày tải lên :
07/03/2014, 15:20
... into American markets (C H AS E , 2000; W ATE RM A N and J AYA KAR , 2000) There are no doubt also marketing difficulties that foreign films in the US face as a result of peculiarities of language and ... example, still own large-scale sound stages, and maintain significant pre- and post-production facilities, all of which are also available for lease by outside companies.5 That said, as any given production ... competitive advantages in the form of increasing returns to scale and scope and positive agglomeration economies Such advantages are fundamental in maintaining the status of the region as the leading...
- 19
- 703
- 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
Ngày tải lên :
07/03/2014, 21:20
... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... green of Fig.2) amyAspka a- amylase amyAspnd a- amylase amyBacsp a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu ... emersonii Aspergillus awamori Aspergillus niger T21 Neurospora crassa AAB02927 AAT58037 BAA00331 AAB59296 AAB20818 BAA01254 L15383 BAA08436 CAA47945 AAA33386 AAF75523 AAE15056 AAR61398 BAD06004 AAP04499...
- 17
- 476
- 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx
Ngày tải lên :
09/03/2014, 01:20
... project of man-machine communication called TIBAQ (Text-and-Inference Based Answering of Questions, cf (Haji~ov@ and Sgall, 1981)) with no pre-arranged data base and with the capacity of self-enriching ... past and future), mood (indicative and imperative), and voice (active and passive) As concerns notation, usually several kinds of information are collapsed in a single abbreviation, cf K standing ... that it cen~ disi~ense with ar~ dictionary as well as with the notion of morphemic irregularity; moreover, it is capable of an interaction with the other levels of analysis, as well as of various...
- 8
- 414
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
Ngày tải lên :
14/03/2014, 23:20
... CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT ... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom PPP6C-forward PPP6C-reverse 2052 FEBS Journal 278 (2011) ... by gain and loss of function approaches MTT, colony formation and growth curve assays show that miR-373 can increase the growth of those cells, and FACS analysis indicates that miR-373 can promote...
- 11
- 396
- 0