a new method of imputation in survey sampling
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
Ngày tải lên :
18/02/2014, 00:20
... level of trust, extent of
role specialization, level of coordination or manage-
ment, and level of feedback and information avail-
able. When certain levels are reached among these
variables, new ... blues—emotions are a way of thinking
that co-evolved with the increasing sophistication of
human group formation. Emotions provide a non-
rational means of bonding, trusting, judging, and
monitoring that ... computing and ad
hoc knowledge sharing, Rheingold points to a vari-
ety of new knowledge collectives, including
Wikipedia, Amazon, OhmyNews, SourceForge, and
Slashdot. Wikipedia is a particularly interesting
experiment...
- 67
- 893
- 0
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf
Ngày tải lên :
18/02/2014, 21:20
... subsidiaries
Investing in training employees to
manage sustainability
Engaging in collaborations & partnerships
Incorporating sustainability issues into
discussions with financial analysts ... to advancing sustainability in the sector, with
a unique insight in the views of CEOs and global leaders
on what it will take to reach a new era of sustainability.
Keith Barringer
Global Managing ... relationships
in emerging markets. Natura has adopted a business
strategy of investing in a new product platform
based on the sustainable use of natural resources and
respect for regional and...
- 36
- 556
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
Ngày tải lên :
07/03/2014, 02:20
... [1]. As a DD-containing and
death effector domain-containing proapoptotic adaptor
molecule, FADD is essential to recruit the initiator
caspases-8 and -10 to instigate formation of the death-
inducing ... compartmentalization of
FADD as a novel regulatory mechanism in death receptor signaling.
Abbreviations
BFA, brefeldin A; DAPI, 4Â,6-diamidino-2-phenylindole; DD, death domain; DISC, death-inducing signaling ... endosomes and cas-
pase activation, our data indicate that CD95 triggering
induces additional, plasma membrane proximal signals.
The elucidation of the molecular pathways involved in
connecting CD95...
- 10
- 483
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... nóng ẩm quanh năm.
Độ ẩm trung bình hằng năm từ 80 – 90 %. Thời tiết hai m a m a, nắng. M a
m a kéo dài từ tháng tư đến tháng mười. Lượng m a dồi dào, 90% lượng m a
tập trung vào m a m a. ĐBSCL ... thông qua các tài liệu có được c a các tác giả đi trước, qua thực tiễn lời
ăn tiếng nói hằng ngày c a người dân đ a phương, luận văn nhằm tìm hiểu về
định danh từ vựng c a PNNB, đ a ra những ... niệm “sự cố định
(hay gắn) cho một kí hiệu ngôn ngữ một khái niệm – biểu niệm (signifikat) phản
-47-
đ a lí tự nhiên Nam Bộ mà chúng ta đang quan niệm hiện nay. Đây cũng là quan
điểm trong việc...
- 137
- 853
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... using the following primers: LTA-1F, 5Â-CTC
GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA-
1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former,
and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â
and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA
GGGG-3Â ... long-term
culture of organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki Yoshida and ... (data not shown), indicating
that the cells maintained the physiological characteristic
of acetylated-LDL uptake.
Lyve-1-positive liver sinusoidal endothelial cells
in vitro
Intriguingly, almost...
- 11
- 873
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
Ngày tải lên :
14/03/2014, 23:20
... ATTTCAGCAGCATACTCCACAATAAAAAG
PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA
TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA
PPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT
TGATCTCTTGAACAAATTACTTACACAAAGAG
PPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6,
functions as an oncogene in hepatocellular carcinoma
Nannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong and
Hua ... PPP6C antisense as above; b-actin sense, 5Â-CGTGAC-
ATTAAGGAGAAGCTG-3Â; and b-actin antisense, 5Â-CT-
AGAAGCATTTGCGGTGGAC-3Â. PCR cycles were as
follows: 94 °C for 5 min, followed by 40 cycles at...
- 11
- 396
- 0
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt
Ngày tải lên :
22/03/2014, 18:20
... to maintain the
mass-44 ion beam at a current of 160 nA. Each analysis in-
volves 10 cycles of sample-standard comparison and each
cycle involves 8 s integration of sample and standard ion
beams. ... maintain a constant isotopic
composition of solution during experiments or between
sampling and final analyses; and analytical errors in deter-
minations of the d
18
O of water and carbonate. All ... with
our inorganic calcite calibration curve indicates several
important things about the analysis of D
47
values in nat-
ural carbonates:
ã First,aragoniteandcalcite appear toexhibitthesamerela-
tionship...
- 18
- 472
- 0
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc
Ngày tải lên :
23/03/2014, 06:20
... containing various amounts
of AdK (0.1–4.0 nmol in a final volume of 0.25 mL) and a fixed
amount of MK (0.0008 nmol) in the absence of ADA. Inset:
Scatchard plot.
D. Vannoni et al. Formation of ADP ... revealed the disap-
pearance of ADP and the formation of an ATP peak,
which was identified in the chromatogram using the same
criteria as for ADP and inosine.
CE analysis
All of the above compounds ... mechanism involves the association of
adenosine kinase and myokinase through non-covalent, transient interac-
tions that induce slight conformational changes in the active site of
myokinase, bringing...
- 15
- 378
- 0
philosophy in the modern world a new history of western philosophy volume 4 jun 2007
Ngày tải lên :
11/06/2014, 10:25
... enthusiasm of Cardinal Manning,
head of the Catholic Church in England, for the Vatican Council’s defin-
ition of Papal Infallibility in 1870. Nonetheless, he was in 1879 made a
cardinal by Pope ... church,
and acquired a lasting fame as a preacher. After an evangelical upbringing
he became convinced, over the years, of the truth of the Catholic interpre-
tation of Christianity. He was one of ... Publication Data
Data available
Library of Congress Cataloging in Publication Data
Data available
Typeset by SPI Publisher Services, Pondicherry, India
Printed in Great Britain
on acid-free paper by
Biddles...
- 364
- 422
- 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
Ngày tải lên :
18/06/2014, 15:20
... resuspended in PBS (Gibco – Invitrogen,
Carlsbad, CA) at a concentration of 1.0 ì 10
5
cells/mL and
stained with saturating concentration of antibodies. After
45 minute incubation in the dark at room ... Carlsbad, CA)
in plastic flasks (25 cm
2
), and maintained in a humidified
atmosphere of 5% CO
2
in air at 37°C. The culture
medium used for expansion was initially changed every
72 hours and ... mesenchymal nature of the
isolated cells and their multipotency.
Population doubling and karyotypic analysisFigure 2
Population doubling and karyotypic analysis. Panel A) Results of hFTs lineage in passage...
- 10
- 456
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
Ngày tải lên :
18/06/2014, 16:20
... data workup, statistical analysis and drafted the manuscript, VS
was involved in technical assistance and in writing the manuscript, HD
carried out H&E staining and CK19 IHC, CS coordinated ... staging of lymph atic metastases in CRC and
enables the examination of whole LN. It can be applied as a rapid diagnostic tool to estimate tumo ur involvement
in LN during the staging of CRC.
Introduction
Carcinomas ... This scenario suggests that Haema-
toxylin and Eosin staining (H&E) as the current method
applied to assess the nodal status of CRC patients may
not be fully adequate. Small metastases (<5...
- 6
- 535
- 0
Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt
Ngày tải lên :
18/06/2014, 22:20
... Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y:
Molecular structure of a gene, VMA1, encoding the catalytic
subunit of H(+)-translocating adenosine triphosphatase
from vacuolar ... identification and bioinformatics characterization of an intein in the
DNA polymerase PolB gene of amoeba infecting Mimivirus, the largest known double-stranded
DNA virus, the origin of which has been ... remotely related
organisms. Proc Natl Acad Sci U S A 1997, 94:7851-7856.
21. Tajima K, Nagamine T, Matsui H, Nakamura M, Aminov RI: Phyloge-
netic analysis of archaeal 16S rRNA libraries from...
- 7
- 435
- 0
báo cáo hóa học:" A new example of viral intein in Mimivirus" potx
Ngày tải lên :
20/06/2014, 04:20
... Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y:
Molecular structure of a gene, VMA1, encoding the catalytic
subunit of H(+)-translocating adenosine triphosphatase
from vacuolar ... Variola virus, Asfarvirus, eukaryotic DNA polymerase α and δ catalytic subunits, and
archaeal DNA polymerase I. Intein containing genes are indicated by bold letters in the figure. Numbers in ... remotely related
organisms. Proc Natl Acad Sci U S A 1997, 94:7851-7856.
21. Tajima K, Nagamine T, Matsui H, Nakamura M, Aminov RI: Phyloge-
netic analysis of archaeal 16S rRNA libraries from...
- 7
- 321
- 0
Báo cáo toán học: " Existence of solutions of a new system of generalized variational inequalities in Banach spaces" ppt
Ngày tải lên :
20/06/2014, 21:20
... Applications in Nonlinear Analysis. Marcel-Dekker, New York
24. Verma, RU: Iterative algorithms and a new system of nonlinear quasivariational inequalities.
Adv. Nonlinear Var. Inequal. 4(1), 117–124 ... by
V IP (A, K), is to find x
∗
∈ K such that
Ax
∗
, z − x
∗
≥ 0
for all z ∈ K. The variational inequality has emerged as a fascinating and interesting
branch of mathematical and engineering sciences ... and quasiconcave on B for all a ∈ A,
then
inf
a A
max
b∈B
p (a, b) = max
b∈B
inf
a A
p (a, b).
Definition 2.6 (KKM mapping). Let K be a nonempty subset of a linear space E. A
set-valued mapping G...
- 21
- 387
- 0
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf
Ngày tải lên :
21/06/2014, 07:20
... Least-Squares and Minimax Group-Delay
Error Design of Allpass Variable Fractional-Delay Digital Filters
Cheng-Han Chan,
1
Soo-Chang Pei (EURASIP Member),
2
and Jong-Jy Shyu
3
1
Department of Aviation and ... Communication Electronics, Air Force Institute of Technology, Kaohsiung 820, Taiwan
2
Department of Electrical Engineering, National Taiwan University, Taipei 106, Taiwan
3
Department of Electrical ... the
minimization of root-mean-squared group-delay error. In the inner loop, an iterative quadratic optimization is proposed to
replace the original nonlinear optimization for the minimization of...
- 10
- 490
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2