a new frontier for orthotics and prosthetics application of dielectric elastomer actuators to bionics

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20
... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
  • 11
  • 873
  • 0
Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt

Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt

Ngày tải lên : 23/03/2014, 00:20
... dedicated funding streams and annual appropriations NASA (an IGA) receives annual appropriations In the case of annual appropriations, the Senate and House will be required to authorize and appropriate ... OLMS Office of Labor-Management Standards OMB Office of Management and Budget OPIC Overseas Private Investment Corporation OSHA Occupational Safety and Health Administration PMA power marketing administration ... Financing and Managing the Civilian Radioactive Waste Management Program, 2001 12 OCRWM’s annual appropriations varied by as much as 20 percent from year to year, and its average annual shortfall...
  • 132
  • 357
  • 0
báo cáo khoa học: "The behaviour change wheel: A new method for characterising and designing behaviour change interventions" pps

báo cáo khoa học: "The behaviour change wheel: A new method for characterising and designing behaviour change interventions" pps

Ngày tải lên : 10/08/2014, 10:23
... developed into a theory- and evidence-based tool allowing a range of users to design and select interventions and policies according to an analysis of the nature of the behaviour, the mechanisms that ... problem arises because automatic motivational factors are currently working against the behaviour (e.g., lack of emotional reward for giving advice or punishment for not giving it and lack of cues to ... method that incorporates an understanding of the nature of the behaviour to be changed, and an appropriate system for characterising interventions and their components that can make use of this...
  • 12
  • 328
  • 0
The future of finance a new model for banking and investment

The future of finance a new model for banking and investment

Ngày tải lên : 30/10/2014, 16:18
... 1.2 A REVIEW OF THE FINANCIAL CRASH Overview of MENA Currency and Interest Rate Market Saudi UAE Bahraini Qatari Omani Moroccan Dinar Dirham Dinar Rial Rial Dirham SAR Fully Kuwaiti Arabia KWD AED ... Too-Big -to- Fail Bank, Moral Hazard, and Macroprudential Regulation Banks and Moral Hazard Addressing Too-Big -to- Fail: Mitigating Moral Hazard Risk Macroprudential Regulation: Regulating Bank Systemic ... Globalization flourished as markets opened up; new capital was made available to business with Latin America, Asia, and Central and Eastern Europe.1 A paradox of this development was that, by opening...
  • 227
  • 508
  • 2
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Ngày tải lên : 18/02/2014, 13:20
... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart ... E22Q and D23N), and the availability of a rapid and simple expression and purification protocol will facilitate large-scale investigations of the molecular determinants of aggregation and fibrillation...
  • 16
  • 691
  • 0
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

Ngày tải lên : 31/03/2014, 21:21
... principles of a- Hsp assembly and the relation between complex formation and chaperone activity, we constructed a series of truncated and point-mutated a- Hsp variants A total of 19 a- Hsp derivatives ... HspH(Na)-His after purification; lane 4, copurification of HspH(Na) and HspH(Na)-His; lane 5, untagged HspH(Na) application to the Ni-nitrilotriacetic acid a nity column ison with mammalian a- crystallins, ... derivatives Lane 1, purification of the His6-tagged HspH variant; lane 2, His6-tagged HspH variant and untagged HspH after copurification (B) Interaction of tagged and untagged HspH(Na) Lane 3,...
  • 9
  • 467
  • 0
báo cáo hóa học:" Research Article A Formal Model for Performance and Energy Evaluation of Embedded Systems" pot

báo cáo hóa học:" Research Article A Formal Model for Performance and Energy Evaluation of Embedded Systems" pot

Ngày tải lên : 21/06/2014, 11:20
... The AMALGHMA (Advanced Measurement Algorithms for Hardware Architectures) tool has been implemented for automating the measuring activities AMALGHMA adopts a set of statistical methods, such as ... performance and energy consumption estimation A tool, named PECES, was implemented for automatizing the method Additionally, a measuring platform, named AMALGHMA, was constructed for characterizing ... executed, measured, and then the obtained data were statistically analyzed For example, to capture the average power consumption when a MAM miss occurs, an assembly code that forces MAM misses was designed...
  • 12
  • 483
  • 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Ngày tải lên : 11/08/2014, 10:23
... µCi/well of 3H-thymidine was added to each well and the plates harvested 18 h later Irradiated PBMC from the original DC donor were also used as stimulators as a control The average cpm and standard ... before FACS analysis to exclude dead cells and enumerate mDC viability The samples were run on a FACScalibur or FACScanto flow cytometer and analyzed using FlowJo 7.2.2 software (Tree Star Inc., Ashland, ... here is an new and more practical way to generate large numbers of mature DC with potent APC activity for vaccine applications or large scale laboratory studies where > 100 million mDC are routinely...
  • 11
  • 469
  • 0
báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot

báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot

Ngày tải lên : 12/08/2014, 03:21
... oleracea var gemmifera) and rutabaga (swedes) (Brassica napus var napobrassica) [6,7] P brassicae is mostly associated with post-harvest damage that limits the marketability of cabbage heads and can ... oleracea var alba Brassica oleracea var.gemmifera Brassica rapa subsp.pekinensis Brassica oleracea var.gemmifera 2.9 0.1 4.9 0.4 5.9 0.4 3.5 0.2 6.0 0.2 a the average size in cm2 of at least ... Hyaloperonospora arabidopsidis, Albugo candida and two Phytophthora species, P cinnamoni and P brassicae [1,11-13] The best studied Phytophthora species, i.e P infestans and P sojae, are incapable...
  • 7
  • 340
  • 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Ngày tải lên : 12/08/2014, 17:22
... 1RO1CA140197 and CA140832 to SKK; 1RO1AI1076562 to CR) and a National Multiple Sclerosis Society research grant (RG3891 to CR) Author details Department of Dermatology, University of Alabama at ... inflammation-associated skin diseases including skin cancers [9,10] The physician and the patients want to understand the real targets and mechanism of action of GTPs that lead to the prevention of ... binding to the IL-1 receptor, the receptor for both IL-1α and IL-1β [5] Therapeutic use of an IL-1 receptor agonist, anakinra, to antagonize IL-1 (IL-1α and IL-1β) activity is a US Food and Drug Administration...
  • 2
  • 338
  • 0
In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel

In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel

Ngày tải lên : 09/10/2015, 11:18
... chemotherapy, radiation therapy, immunotherapy, monoclonal antibody therapy and gene therapy Each method has its advantages and disadvantages, and depends on the physiology of the individuals as an ... of a wide range of local or metastatic malignancies such as ovarian, breast, head and neck and non-small-cell lung cancers (NSCLC) (Eisenhauer and Vermorken, 1998) On the other hand, they are also ... years in developing localized and sustained treatment for cancer and other fatal diseases such as cardiovascular restenosis Biodegradable polymeric carriers have become a promising platform for...
  • 163
  • 932
  • 0
Báo cáo khoa học: "Analysis of the seroprevalence of bovine paratuberculosis and the application of modified absorbed ELISA to field sample testing in Korea" potx

Báo cáo khoa học: "Analysis of the seroprevalence of bovine paratuberculosis and the application of modified absorbed ELISA to field sample testing in Korea" potx

Ngày tải lên : 07/08/2014, 18:21
... noitagitsevni launna na fo trap sa ecivreS enitnarauQ dna hcraeseR yranireteV lanoitaN eht yb detcelloc ylmodnar erew areS selpmas tseT sdohteM dna slairetaM la te kraP keaT nuK 053 gnitceted rof ... ffotuc elbatius a enimreted ot dna tset gnineercs a sa ASILE-P fo ycaciffe eht ezylana ot demrofrep saw sisylana COR ,stluser ASILE-C no desaB stluseR )KU ,ti-esylanA( erawtfos elbaliava yllaicremmoc ... deppots saw noitcaer sihT dedda saw )ASU ,seirotarobaL yrreP & draagekriK ;STBA( etartsbus esadixorep fo lµ 001 dna ,semit dehsaw ,nim 03 rof detabucni neht erew setalP llew hcae ot dedda saw )ASU...
  • 6
  • 248
  • 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Ngày tải lên : 31/10/2012, 14:59
... renal impairment Standard measures to prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that ... dose of rasburicase, according to the various clinical states, the type of malignancy and drugs used The use of low doses of rasburicase may permit to spare the total cost on the management of patients ... of hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing...
  • 11
  • 715
  • 0
A New Vision for Adolescent Sexual and Reproductive Health pot

A New Vision for Adolescent Sexual and Reproductive Health pot

Ngày tải lên : 05/03/2014, 17:20
... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... methods than are their American peers As noted, they are less likely to be poor and they have greater access to sexual and reproductive health care services Dutch policy makers and health care providers,...
  • 7
  • 662
  • 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Ngày tải lên : 07/03/2014, 09:20
... 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed ... Tsukuba T, Okamoto K, Okamoto Y, Yanagawa M, Kohmura K, Yasuda Y, Uchi H, Nakahara T, Furue M, Nakayama K, et al (2003) Association of cathepsin E deficiency with development of atopic dermatitis ... T, Kato Y & Yamamoto K (1989) Quantitation and immunohistochemical localization of cathepsins E and D in rat tissues and blood cells Biochim Biophys Acta 991, 367–375 Sastradipura DF, Nakanishi...
  • 12
  • 645
  • 0
Food and health in Europe: a new basis for action pdf

Food and health in Europe: a new basis for action pdf

Ngày tải lên : 16/03/2014, 14:20
... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... programme geared to the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic ... chemical and biological, at all stages of the food chain The potential impact of unsafe food on human health is of great concern, and new food safety systems that take a farm -to- fork perspective are...
  • 38
  • 334
  • 0
Food and health in Europe: a new basis for action pptx

Food and health in Europe: a new basis for action pptx

Ngày tải lên : 28/03/2014, 23:20
... Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary a TFYR Macedonia Israel Uzbekistan Croatia Lithuania Republic of Moldova Azerbaijan Georgia ... Switzerland Finland Austria Ireland Netherlands Sweden Germany Albania Belarus Belgium–Luxembourg Greece Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal ... additional material added to the analysis They have the advantage of providing the basis for a democratic form of decision-making, and can increase the transparency of the processes and of the...
  • 405
  • 635
  • 0
RBF Neurals Networks and a new algorithm for training RBF networks

RBF Neurals Networks and a new algorithm for training RBF networks

Ngày tải lên : 12/04/2014, 15:40
... is a non-linear function of distance from input vector X and center vector C j combined with neural j with basic radial σ j The combination of input vector X and center vector C j creates a matrix ... Morgan Kaufmann, 1987 E Blanzieri, “Theoretical Interpretations and Applications of Radial Basis Function Networks”, Technical Report DIT-03-023, Informatica e Telecomunicazioni, University of ... Function Approximation Using Robust Radial Basis Function Networks, Journal of Intelligent Learning Systems and Applications, Vol.3 No.1, February 2011, pp 17-25 20 Tomohiro Ando, Sadanori Konishi and...
  • 22
  • 270
  • 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Ngày tải lên : 18/06/2014, 16:20
... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed ... Cite this article as: Arai et al., Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in ... were among the "inventoried" assays available from ABI, and are described in Table cDNA synthesis, preparation of samples for TLDA assay and measurements of RNA concentration were performed as...
  • 13
  • 528
  • 0
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

Ngày tải lên : 18/06/2014, 19:20
... bioinformatics, and public health B Research: to expand and increase collaborative global and local research initiatives especially on topics of public health importance such as obesity and motor ... predisposition and protein biomarkers for certain types of breast cancer Page of particularly frequent in Arab populations and to translate that to clinical management, including diagnosis, prevention and ... make Qatar a leader in innovative education and research.” Under the leadership of His Highness Sheikh Hamad Bin Khalifa Al-Thani, the Emir of Qatar and founder of Qatar Foundation, and Her Highness...
  • 8
  • 375
  • 0