a multipurpose strategy in breast cancer targeted therapy
Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx
... nodes in the infra or supraclavicular fossa or in the internal mammary chain was considered as a regional recurrence Any recurrence outside these areas was defined as DM Statistical Analysis LRR and ... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and ... clear surgical margins (>1 mm) Axillary lymph node staging was performed in all patients Pathological staging was reviewed based on AJCC 2002 The date of evaluation was January 2009 Patient-related...
- 8
- 357
- 0
báo cáo khoa học: "Individualized therapies in colorectal cancer: KRAS as a marker for response to EGFR-targeted therapy" docx
... supportive care [4,5] KRAS is an important molecule in the EGFR signaling pathway KRAS encodes a membrane-associated GTPase that is an early player in many signal transduction pathways KRAS acts as a molecular ... the intracellular domain is a catalytic site that has tyrosine kinase activity EGFR binds soluble ligands, including epidermal growth factors (EGFs) and transforming growth factor-alpha, and ... Schrama JG, Erdkamp FL, Vos A, Mol L, Antonini NF: Randomized phase III study of capecitabine, oxaliplatin, and bevacizumab with or without cetuximab in advanced colorectal cancer (ACC), the CAIRO2...
- 9
- 311
- 0
In vivo and in vitro study on potential combination therapy of COL 3 and tamoxifen in breast cancer a pilot study
... with early stage cancers to receive combination therapy Examples for combination therapy in breast cancer treatment are shown in Table 1.3 Early in the 1950’s, some encouraging results already ... plasma in patients Also, sodium valproate-pretreated rabbits showed an increase in midazolam brain levels, leading to an increase of the 50 midazolam response[152] Recently, in a pharmacokinetic ... inhibitor, has already undergone phase I clinical trials in patients with refractory metastatic cancer[ 121] and AIDSrelated Kaposi’s sarcoma[122] A random phase II trial reported that COL-3 administered...
- 134
- 360
- 0
Delayed presentation in breast cancer: a study in Iranian women docx
... www-dep.iarc.fr/globocan/globocan.html] Jarvandi S, Montazeri A, Harirchi I and Kazemnejad A: Beliefs and behaviours of Iranian teachers toward early detection of breast cancer and breast self-examination ... operable breast cancer patients Eur J Cancer Prev 2001, 10:53-59 Ebrahimi M, Vahdaninia M and Montazeri A: Risk factors for breast cancer in Iran: a case-control study Breast Cancer Research 2002, ... Iran social values and moral considerations limit the use of mass media for publicizing breast cancer awareness Breast cancer is not taboo but because the breast is regarded as part of female...
- 6
- 766
- 0
báo cáo khoa học: "CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion" pptx
... participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... adenocarcinoma of the pancreas that developed extensive intratumoral calcification European Journal of Radiology Extra 2009, 71(2):e65-e69 Aydemir S, Savranlar A, Engin H, Cihan A, Ustundag Y, ... Malet A, Saigi E, Rey M: Gastrointestinal stromal tumors Abdom Imaging 2006, 31(4):387-399 Chamadol N, Laopaiboon V, Promsorn J, Bhudhisawasd V, Pagkhem A, Pairojkul C: Gastrointestinal stromal tumor:...
- 4
- 231
- 0
Báo cáo khoa học: "A biologically competitive 21 days hypofractionation scheme with weekly concomitant boost in breast cancer radiotherapy feasibility acute sub-acute and short term late effects" pot
... Sydenham MA, Venables K, Yarnold JR: The UK Standardisation of Breast Radiotherapy (START) Trial A of radiotherapy 17 18 19 20 21 22 23 24 hypofractionation for treatment of early breast cancer: a ... concomitant boost in adjuvant radiotherapy for patients with early breast cancer: preliminary results on feasibility Tumori 2008, 94(5):706-11 Primary Therapy of Early Breast Cancer; 9th International ... 362:513-20 Guerrero M, Li XA, Earl MA, Sarfaraz M, Kiggundu E: Simultaneous integrated boost for breast cancer using IMRT: a radiobiological and treatment planning study Int J Radiat Oncol Biol Phys...
- 7
- 275
- 0
Báo cáo khoa học: "An ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation therapy" docx
... postmastectomy breast cancer patients after radiation therapy Huang et al [25] has demonstrated that skin thickness measured via ultrasonic imaging proved to be a reliable quantitative and noninvasive measure ... 25:19-24 Paszat LF, Mackillop WJ, Groome PA: Mortality from myocardial infarction following postlumpectomy radiotherapy for breast cancer: a populationbased study in Ontario, Canada Int J of Radiat ... postmenopausal breast cancer patients given adjuvant tamoxifen Danish Breast Cancer Cooperative Group DBCG 82c randomised trial 1999, 353:1641-1648 Ragaz J, Jackson SM, Le N: Adjuvant radiotherapy and...
- 10
- 324
- 0
Báo cáo y học: "Period-2: a tumor suppressor gene in breast cancer" pdf
... expressed in normal human mammary epithelium and at a reduced level in breast cancer cells leading to an alteration in the cell cycle, cell growth, and cell survival Materials and methods Human breast ... expressing both Per Figure cancer cell of PER Expression lines in human breast epithelial and breast Expression of PER in human breast epithelial and breast cancer cell lines Total cellular protein ... p53 can induce a transient arrest in G1 in cells, allowing cells time to repair damaged DNA [35] Activated p53 can also eliminate cells through mechanisms involving prolonged arrest in G1 and induction...
- 9
- 362
- 0
báo cáo khoa học: " Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy" ppsx
... Asia [1] For centuries, turmeric has been used as a spice and coloring agent in Indian food, as well as a therapeutic agent in traditional Indian medicine Enthusiasm for curcumin as an anti -cancer ... MiaPaCa 16 16 -ve FC NC NFκB κ MIAPaCa Figure 11 Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell lines Nanocurcumin blocks activation of nuclear factor kappa ... nuclear factor-kappaB activation pathway by spice-derived phytochemicals: reasoning for seasoning Ann N Y Acad Sci 2004, 1030:434-441 Aggarwal S, Ichikawa H, Takada Y, Sandur SK, Shishodia S, Aggarwal...
- 18
- 312
- 0
Báo cáo y học: " Intracystic papillary carcinoma in a male as a rare presentation of breast cancer: a case report and literature review" potx
... swelling in his left breast He also had a significant family history for breast cancer including a maternal grandmother, two of his maternal aunts and a maternal first cousin diagnosed with breast ... Myoepithelial cell staining patterns of papillary breast lesions: from intraductal papillomas to invasive papillary carcinomas Am J Clin Pathol 2005, 123:36-44 Ganesan S, Karthik G, Joshi M, Damodaran ... Intracystic papillary carcinoma: a review of 917 cases Cancer 2008, 113:916-920 Dragoumis DM, Tsiftsoglou AP: Intracystic papillary carcinoma associated with ductal carcinoma in situ in a male breast...
- 4
- 322
- 0
Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc
... prognostic biomarkers Apart from breast cancer, the prognostic value of KLK5 expression has already been demonstrated for ovarian, bladder, prostate, colorectal and testicular cancer In ovarian cancer, ... physical barriers and cells’ interaction, facilitating angiogenesis and cancer cells’ invasiveness and metastasis [2] Moreover, during the early stages of the disease, KLKs influence the availability ... expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions Margaritis Avgeris1, Georgia Papachristopoulou1,2, Athanasios Polychronis2 and Andreas Scorilas1*...
- 12
- 340
- 0
Estrogen receptor a mediated long rang chromatin interactions at the ret gene locus in breast cancer
... CATGGGAGAAAGATGTAGTCTGGGAGAC B CTCTTTCGGGACACAGCATCATAATC B CTCTTTCGGGACACAGCATCATAATC C GAAAGGACAGAGAAGGTGCCAGTTG B TTCGGGACACAGCATCATAA D ATCAAACTGGAGGGAGCAGA B TCAGACAGTGCCAGTGGAAG E GCCAGTGGAAGTGTAAGTTGG ... B TCGGGACACAGCATCATAA F GACACTGACAGGATTTACCATACTGTTGG B TCGGGACACAGCATCATAA G GGTCAAGTGTTCCCGTGATCCTACTG B TCGGGACACAGCATCATAA H CACAGGGAAATGCAGCACAGCTAG B AACCCCGTGTGTCCTTCAG I ACCGTCACTTTCCCTGTGTT ... GAACCTCGAGGCCCTGAATTGCCTTGATATCCAGCTCCCAGGAAC AP2γ in ERBS TCCGGGACAACGCGAACAGGGGCTCTGGAC AP1 in ERBS GCAGGTGAGACTGGCAAAGTTTGACCTGCTGCCGG AP4 in ERBS CTGAGTCAGACAAGCAACCGGGGCAGACGCAGGACAAGG FoxA1 in...
- 90
- 412
- 0
Tài liệu Guidance on Cancer Services Improving Outcomes in Breast Cancer pdf
... discharge in patients over 50 years of age Clinical breast examination in primary care Each primary care team should include at least one practitioner who has had specific training in carrying ... supporting strategies for breast cancer patients D Measurement Structure • Availability of information in cancer units about breast cancer and its treatment • • 30 Availability of training courses ... progress • Familial breast cancer: classification and care of women at risk of familial breast cancer in primary, secondary and tertiary care - clinical guideline (expected date of issue, Winter 2003)...
- 113
- 321
- 0
European guidelines for quality assurance in breast cancer screening and diagnosis pot
... of cases • Rate per 100,000 • World ASR* in the year NA NA NA NA Advanced breast cancer incidence* • Absolute number of cases • Rate per 100,000 • World ASR* in the year NA NA NA NA Breast cancer ... lessons learned in the European Breast Cancer Network in which scientists, clinicians and paramedical staff as well as advocates, health care planners and administrators across Europe have shared ... ASSURANCE IN BREAST CANCER SCREENING 1.1 Introduction That a breast cancer screening programme can reduce breast cancer mortality in the age group 40-74 years has been shown in several randomised...
- 432
- 460
- 0
Targeting New Pathways and Cell Death in Breast Cancer Edited by Rebecca L. Aft docx
... to Clinical Relevance Philipp Y Maximov and V Craig Jordan Chapter Targeted Apoptosis in Breast Cancer Immunotherapy 23 Lin-Tao Jia and An-Gang Yang Chapter Induction of Apoptosis in Human Cancer ... Ali, Bassam Bitar, Farah T Logna, Main Y Maitah, Bin Bao, Shadan Ali, Dejuan Kong, Yiwei Li and Fazlul H Sarkar Chapter Multidrug Resistence and Breast Cancer Gengyin Zhou and Xiaofang Zhang Chapter ... the adaptor molecule Fas-associated death domain (FADD) via interaction between their death domains (DD) FADD also contains a death effector domain (DED), which aggregates and activates another...
- 190
- 414
- 0
Báo cáo Y học: Progestin upregulates G-protein-coupled receptor 30 in breast cancer cells pot
... (Amersham Pharmacia Biotech) were used for PCR: GPR30-forward, 5¢-AGTCGG ATGTGAGGTTCAG-3¢; GPR30-reverse, 5¢-TCTGTGT GAGGAGTGCAAG-3¢; TBP-forward, 5¢-TTTGGAAG AGCAACAAAGG-3¢; TBP-reverse, 5¢-AAGGGTGCAG ... the total RNA Statistical analysis Data for the correlation analysis were handled using a regression analysis of SSPI and/or a correlation analysis of EXCEL Data for the growth studies and immunochemistry ... proliferation was measured using BrdU and immunostaining (C) GPR30 upregulation (h) in different breast cancer cell lines correlated with growth (j) RNA was analysed by quantitative PCR using a LightCycler...
- 6
- 425
- 0
Báo cáo khoa học: BRCA1 accumulates in the nucleus in response to hypoxia and TRAIL and enhances TRAIL-induced apoptosis in breast cancer cells pdf
... not alter the localization of truncated BRCA1 or induce apoptosis in a cell line expressing mutated BRCA1 The data in Figs and suggest that TRAIL can alter BRCA1 localization and induce apoptosis ... as hypoxia A B induced changes in BRCA1 localization in malignant, but not in nonmalignant, mammary epithelial cells, we sought to determine whether TRAIL was involved in the localization change ... the involvement of a TRAIL-dependent process in mediating hypoxiainduced changes in BRCA1 localization TRAIL, but not hypoxia, induces apoptosis in breast cancer cells As our data suggested that...
- 10
- 392
- 0
Báo cáo khoa học: Towards discovery-driven translational research in breast cancer pdf
... detect breast cancer at a very early stage, as early detection increases survival rate Today, many cancers are detected late, when spreading to the surrounding tissue and metastases has taken place ... et al Translational research in breast cancer A Fig IHC of nonmalignant epithelial cells (A) and tumour cells (B) from patient 46 using IL-6 antibodies (C) Haematoxylin and eosin staining of fat ... FEBS Translational research in breast cancer Wnt ⁄ b-catenin signalling cascade [78–80] The latter plays an important role in development by augmenting the signalling activity of b-catenin, a structural...
- 14
- 338
- 0
báo cáo hóa học:" Optical imaging of the peri-tumoral inflammatory response in breast cancer" docx
... addition, breast cancer patients have been previously scanned using optical imaging; initial results indicate that this technique may supplement mammography and magnetic resonance imaging in breast cancer ... crosstalk between adaptive and innate immune cells during breast cancer progression Breast Cancer Res 2007, 9:212 Balkwill F, Charles KA, Mantovani A: Smoldering and polarized inflammation in the initiation ... protein-1 in macrophage recruitment, angiogenesis, and survival in human breast cancer Clin Cancer Res 2000, 6:3282-3289 Jin H, Su J, Garmy-Susini B, Kleeman J, Varner J: Integrin alpha4beta1 promotes...
- 9
- 742
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25