a multiaxial fatigue life criterion for non symmetrical and non proportional elasto plastic deformation
Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx
Ngày tải lên :
08/08/2014, 23:22
... is 8.4 °C In early October 1960 and 1986 sampling for humus characterization (area m was carried ) out before the main litter fall and after mapping the humus form and the typical sequence of ... ≈ 50% mineral particles 30% leaf and pod Ah1 (2-5) Sandy loam, little litter and many animal faeces (0.26 g/cm The worm faeces (giv) ing a crumb structure) contain only 20% organic matter Ah2 ... surfaces are covered with Collembola faeces Of (3.5-1.5) 20% fibrous twigs and skeletal leaf pieces The leaf pieces and the Enchytraeidae and Oribatidae faecal pellets are stored in alternate layers...
- 12
- 210
- 0
Báo cáo vật lý: "Effect of Temperature on Corrosion Behavior of AISI 304 Stainless Steel with Magnesium Carbonate Deposit" docx
Ngày tải lên :
07/08/2014, 14:20
... abbreviations, diagrams and reference to the text Malaysian author(s) should, in addition, submit a Bahasa Malaysia abstract Articles written in Bahasa Malaysia must contain an English title and abstract ... The authors are very grateful to the Ministry of High Education, Malaysia for Research Grant: 9003-00144 Also thanks to Director of Department of Occupational Safety and Health Malaysia for his ... Dental Science, Healthy Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan, Malaysia, e-mail: arismail@usm.my Submission of an article implies that it has not been published and...
- 8
- 512
- 0
Báo cáo y học: "Absence of a serum melatonin rhythm under acutely extended darkness in the horse" ppsx
Ngày tải lên :
10/08/2014, 09:20
... design, sample collection, data analysis and interpretation, and prepared the manuscript JAE contributed to study design, data analysis, interpretation and figure preparation, ran the MT RIA, and ... [23] Cortisol radioimmunoassay (RIA) Cortisol was measured using a Coat a Count assay kit (Siemens, LA, USA) 25 μl of serum samples, QC samples (at three levels) and calibration standards (0-50 μg/ ... re-entrainment rates of plasma melatonin and core body temperature following an abrupt 6-h phase advance of the LD cycle [23] In contrast to studies that demonstrate a gradual adaptation of melatonin...
- 8
- 325
- 0
Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot
Ngày tải lên :
11/08/2014, 21:22
... manuscript All authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy ... clear urine via Figure fat saturation and gadolinium enhancement T1-weighted coronal magnetic resonance imaging scan with T1-weighted coronal magnetic resonance imaging scan with fat saturation ... differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule was likely to be an abscess rather than a tumour Again no...
- 3
- 306
- 0
Cyclic and post cyclic behaviour of soft clays
Ngày tải lên :
09/09/2015, 11:10
... instance, Zanvoral and Campanella (1994) and Thammathiwat and Weeraya (2004) found that damping in clays increases with loading frequency while Shibuya et al (1995) and Teachavorasinskun et al (2002) ... (Hardin and Black 1968; Anderson and Richart 1976; Kokusho et al 1982; Viggiani and Atkinson 1995; Dasari 1996), strain-dependent shear modulus and damping ratio (Hardin and Drnevich 197 2a and 1972b; ... Clay and present a detailed characterization of its dynamic properties (e.g small-strain shear modulus and damping ratio, variations in strain-dependent modulus degradation and damping behaviour),...
- 246
- 603
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
Ngày tải lên :
25/10/2012, 11:00
... non- parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... Turkish official gazette 2003 National Committee for Clinical Laboratory Standards Performance Standards for Antimicrobial Susceptibility Testing Wayne, PA, USA: 13th Informational Supplement ... G, Markogiannakis A, Papaparaskevas J, Daikos GL, Stefanakos G, Zissis NP, Avlamis A Differences in the changes in resistance patterns to third- and fourth-generation cephalosporins and piperacillin/tazobactam...
- 6
- 692
- 0
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
Ngày tải lên :
16/03/2014, 10:20
... ratio change in favor of n-3 PUFA and particularly an n-3 DPA and EPA An increase in n-3 DPA and EPA, and perhaps other n-3 PUFAs, stimulates Jak2 and Stat5 activation, and induces b-casein expression ... of mammary differentiation Using MCF-10 mammary epithelial cells, we analyzed the effect of DPA, EPA, and DHA on activation of Jak2 and Stat5 Whereas DPA and EPA activated Jak2 and Stat5, DHA did ... 5¢-TTCTTAACCC CACCGTCCAA-3¢; reverse primer: 5¢-GAAAATAACCT GGAAATCCTCTTAGACA-3¢; probe: 5¢-TCCCTGCCA CTCCACAACATTCCG-3¢ Statistical analysis Stat5 knockout mice Mice homozygous for the Stat5atm1Mam...
- 12
- 421
- 0
Source investigation of a small event using empirical Green’s functions and simulated annealing ppt
Ngày tải lên :
23/03/2014, 13:20
... Meur and especially A Rigo, for accurate focal mechanism determinations, C Wajeman for moment calculations and H Lyon-Caen for her help in retrieving data We would also like to thank Scotti for a ... between 0.1 and cm and a stress drop of between I and 10 bar for a rise time equal to At, and a stress drop that can reach 30 bar for a rise time equal to twice At We d o not show results for longer ... is a geometrical factor of about 1.0 and L is the fault dimension, quantities estimated by our analysis Results for stress drop, total active arca and avcrage total slip are shown in Table for...
- 13
- 486
- 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot
Ngày tải lên :
31/03/2014, 07:20
... Time-course for the anaerobic reaction between FNRrd and Adxox using a constant FNR concentration and increasing [Adxox]/[FNRrd] ratios (A) Time-course for the anaerobic reaction between FNRrd and Adxox ... have examined these requirements for productive complex formation and ET, by using a heterologous system that consists of cyanobacterial FNR and adrenal bovine Adx Anabaena PCC 7119 FNR contains ... parameters for the anaerobic reaction between FNRrd and Adxox Data calculated from steady-state spectra recorded in Fig 2A at 414 nm Adx concentration dependence of (A) kobs1, kobs2 and V0 (lines are...
- 10
- 400
- 0
Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf
Ngày tải lên :
20/06/2014, 01:20
... Microarray-based detection and genotyping of viral pathogens Proc Natl Acad Sci U S A 2002, 99:15687-15692 Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, Dalianis T, Ramqvist ... ligase (Roche, Mannheim, Germany) The first amplification stage (20 cycles, 50 μl reaction volumes) used 300 nM of primers CTCGTAGACTGCGTACGATG and GACGATGAGTACTGATCGC at 56°C annealing temperature ... linkers for the HinP1I-site (GACGATGAGTCCTGAT and Phosphate-CGATCAGGACTCAT, 1:1) and the CviII-site (CTCGTAGACTGCGTACG and Phosphate-ATCGTACGCAGTC, 1:1) were ligated to the complete phenol-purified...
- 10
- 432
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
Ngày tải lên :
21/06/2014, 11:20
... S Ahmad and I M Stamova, “Almost necessary and sufficient conditions for survival of species,” Nonlinear Analysis Real World Applications, vol 5, no 1, pp 219–229, 2004 10 Y.-H Fan and L.-L Wang, ... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka...
- 9
- 351
- 0
báo cáo hóa học:" Research Article The Permanence and Extinction of a Discrete Predator-Prey System with Time Delay and Feedback Controls" ppt
Ngày tải lên :
21/06/2014, 11:20
... Journal of Mathematical Analysis and Applications, vol 281, no 1, pp 395–401, 2003 T K Kar and U K Pahari, “Modelling and analysis of a prey-predator system with stage-structure and harvesting,” Nonlinear ... and Applications, vol 295, no 1, pp 15–39, 2004 10 X Yang, “Uniform persistence and periodic solutions for a discrete predator-prey system with delays,” Journal of Mathematical Analysis and Applications, ... response,” Journal of Mathematical Analysis and Applications, vol 317, no 2, pp 464–474, 2006 D T Dimitrov and H V Kojouharov, “Complete mathematical analysis of predator-prey models with linear prey...
- 20
- 442
- 0
báo cáo hóa học:" Research Article Dynamical Analysis of a Delayed Predator-Prey System with Birth Pulse and Impulsive Harvesting at Different Moments" pdf
Ngày tải lên :
21/06/2014, 11:20
... Pitman Monographs and Surveys in Pure and Applied Mathematics, Longman Scientific & Technical, Harlow, UK, 1993 J Jiao, X Yang, S Cai, and L Chen, “Dynamical analysis of a delayed predator-prey model ... immature population with proportionality constant r We also assume that the death rate of mature population is of a logistic nature, that is, proportional to the square of the population with proportionality ... delays and continuous delays,” International Journal of Biomathematics, vol 1, no 2, pp 179–196, 2008 11 J Jiao, L Chen, and G Luo, “An appropriate pest management SI model with biological and...
- 15
- 289
- 0
báo cáo hóa học:" Dynamical analysis of a biological resource management model with impulsive releasing and harvesting" pdf
Ngày tải lên :
21/06/2014, 17:20
... Dynamical analysis of a biological resource management model with impulsive releasing and harvesting Jianjun Jiao∗1 , Lansun Chen2 and Shaohong Cai1 School of Mathematics and Statistics, ... X, Jiao, J, Chen, L: Global dynamics behaviors for a nonautonomous Lotka– Volterra almost periodic dispersal system with delays Nonlinear Anal Theory Methods Appl 68, 3633–3645 (2008) [8] Jiao, ... China ∗ Corresponding author: jiaojianjun05@126.com Email address: LC: lschen@amss.ac.cn SC: caishaohong@yahoo.com.cn Abstract In this study, we consider a biological resource management predator–prey...
- 31
- 284
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
Ngày tải lên :
09/08/2014, 04:20
... predicted values of water potential are also shown and compared with measured data for the days 178 and1 80 at the Carrasqueira site The values measured by eddy covariance exhibited erratic variations, ... 229 and 243) in 1995 Table II summarises the sampling procedure applied for each variable measured 3.2 Azimuthal variability of sap flux density MATERIALS AND METHODS Azimuthal variations in sap ... particular individuals in a stand Sap flow data have been used for estimating hourly transpiration and canopy conductances in a range of forest stands [1, 10, 13, 19, 20] The sap flow measurements can...
- 18
- 406
- 0
Báo cáo y học: "Demonstration of a novel technique to quantitatively assess inflammatory mediators and cells in rat knee joints" pps
Ngày tải lên :
11/08/2014, 08:21
... vitro assays, data interpretation, statistical analysis and compilation of the manuscript DAS and JPH assisted with the Luminex assay use and data collection, then read and edited the manuscript after ... antibody was added and incubated at ambient temperature for h Streptavidin-peroxidase was added and incubated for 30 After a third incubation and washing to remove all unbound enzyme, colour was developed ... of pentobarbital, fentanyl-droperidol, ketamine-xylazine and ketamine-diazepam on arterial blood pH, blood gases, mean arterial blood pressure and heart rate in adult male rats Lab Anim Sci 1987,...
- 8
- 403
- 0
Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot
Ngày tải lên :
11/08/2014, 14:20
... 1984, the patient’s histopathology revealed a mixed tumour, a choriocarcinoma and an embryonic carcinoma, with retroperitoneal and pulmonary metastases To treat this, an orchiectomy was performed, ... written by Albers and his co-authors Abbreviations AFP, alpha-fetoprotein; BEP, bleomycin, etoposide and cisplatin; CEA, carcinoembryonic antigen; EAU, European Association of Urology; hCG, Human chorionic ... (normal range
- 4
- 294
- 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf
Ngày tải lên :
11/08/2014, 15:22
... They can be used as stand-alone interventions or as an adjunct to other forms of intervention This is a rapidly growing area and a recent meta-analysis of studies evaluating such approaches for ... addressed before a large scale clinical and cost effectiveness evaluation of this approach Specifically, the trial will provide extensive quantitative and qualitative data on the acceptability of ... intervention has been designed to be used by relatives in their own homes and at their own convenience As such, it has been produced as a hard copy format and as a website and participants are able to...
- 7
- 305
- 0