a multi tier web service using j2ee and db2
Create a Simple XML Web Service Using Parameters
Ngày tải lên :
20/10/2013, 13:15
... strPassword are passed, and a Boolean type value is returned The rest of this routine should look somewhat familiar because a DataAdapter object is created, and a DataTable object is filled, based ... match, then False is passed back Listing 13.2 SecurityServices.asmx.vb: Web Method to Validate Username and Password
- 5
- 498
- 0
A MULTI-OBJECTIVE EVOLUTIONARY ALGORITHM USING DIRECTIONS OF IMPROVEMENT AND APPLICATION
Ngày tải lên :
21/01/2015, 15:48
... a Lagrange multiplier, which is a quadratic linear programming with m variables and m linear inequalities and an equality In other proposal [45], the authors define Pareto descent directions and ... be a successful search algorithm needs to establish a good ratio between exploration and exploitation Balancing exploration and exploitation is particularly important here: An algorithm may have ... EDUCATION AND TRAINING MINISTRY OF NATIONAL DEFENSE MILITARY TECHNICAL ACADEMY A MULTI- OBJECTIVE EVOLUTIONARY ALGORITHM USING DIRECTIONS OF IMPROVEMENT AND APPLICATION Specialized in: Fundamentals...
- 173
- 457
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
Ngày tải lên :
16/02/2014, 09:20
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Build Your Own ASP.NET 3.5 Web Site Using C# and VB docx
Ngày tải lên :
08/03/2014, 20:20
... 1997 and has also worked as a high school English teacher, an English teacher in Japan, a window cleaner, a car washer, a kitchen hand, and a furniture salesman At SitePoint he is dedicated to making ... database-driven web applications is to roll up our sleeves and dirty our hands with a little ADO.NET—the technology that facilitates communication between your web application and the database ... in a database, and allow visitors to the site to access and change that information Many different programming technologies and supported languages have been developed to create web applications;...
- 219
- 1.3K
- 0
sitepoint dhtml utopia, modern web design using javascript and dom (2005)
Ngày tải lên :
28/04/2014, 17:08
... That’s a handy and clean separation If you want to look good, you need to learn how to dress up and go to the gym regularly! A Simple CSS Example Imagine you want your main page heading (an tag) ... general, an attribute that can be applied to a tag in your HTML is also gettable and settable as a property on a node from JavaScript So, if our code contains a reference to an img element, we can ... refreshes Chapter 9: Communicating With The Server Communication with the server doesn’t mean simply that the server hands out data Your scripts can also pass data back, and engage in a real dialogue:...
- 336
- 343
- 0
báo cáo khoa học: "A hospital-site controlled intervention using audit and feedback to implement guidelines concerning inappropriate treatment of catheterassociated asymptomatic bacteriuria" pptx
Ngày tải lên :
10/08/2014, 10:23
... 2009, 48:1182-1188 16 Dalen DM, Zvonar RK, Jessamine PG: An evaluation of the management of asymptomatic catheter-associated bacteriuria and candiduria at The Ottawa Hospital Can J Infect Dis Med ... infectious diseases physicians, a geriatrician, a biostatistician, a measurement psychologist, a health economist, and two industrial/organizational psychologists Each site has a research assistant, with ... knowledge awareness, KF measures knowledge familiarity, AA measures awareness acceptance, and OE measures outcome expectancy A = agree; D = disagree; SA = strongly agree; SD = strongly disagree validity...
- 12
- 345
- 0
Báo cáo y học: " Involving relatives in relapse prevention for bipolar disorder: a multi-perspective qualitative study of value and barriers" pptx
Ngày tải lên :
11/08/2014, 16:20
... [29] A qualitative approach was employed which provided rich data grounded in stakeholders views and ideas [30] With 52 participants, the sample was large and thematic saturation was assured A particular ... refined and elaborated in light of incoming data and analysis employing an inductive stance The interviewer conducted the analysis on all interviews In addition, each interview was separately analyzed ... recognized that involving families can provide an additional burden to clinicians’ caseload and require additional clinical skills Additional training and support is necessary for health professionals...
- 29
- 347
- 0
Báo cáo y học: "A multi-target antisense approach against PDE4 and PDE7 reduces smoke-induced lung inflammation in mice" pps
Ngày tải lên :
12/08/2014, 14:20
... cagaatatggtgcactgtgc agtctatgaagcccacctgtg 59 huPDE 7A for huPDE 7A rev tcaggccatgcactgttact cctgattctctcaataagccc 57 huPbib for huPbib rev agagcatctacggtgagcg cttccgcaccacctcca 57 aReverse Annealing ... obtained from COPD patients [14-16] In airways, elevation of intracellular cAMP has been associated with the general suppression of activity of inflammatory cells and relaxation of airway and vascular ... oxygen radicals, elastases and metalloproteases (MMP) that contribute to self-perpetuation of inflammation and promote matrix breakdown, leading to alveolar destruction and emphysema [10-12] Patients...
- 14
- 234
- 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
Ngày tải lên :
05/09/2013, 16:11
... temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged over the day ... Non-conventional solar stills with charcoal particles as absorber medium Desalination 2003, 153(1-3), 55–64 [3] Al-Abbasi M .A. , Al-Karaghouli A. A., Minasian A. N Photochemically assisted solar desalination ... variation of global solar radiation and ambient temperature at Chennai for January to June _ Solar radiation -Ambient temperature Figure Mean monthly hourly variation of global solar radiation...
- 26
- 568
- 0
Viewing a WSDL File and Testing a Web Service
Ngày tải lên :
24/10/2013, 12:15
... method to return a DataSet with a DataTable containing all the rows from the Customers table (see Figure 17.6) Notice that the space characters in the whereClause parameter value have been converted ... xmlns:mime="http://schemas.xmlsoap.org/wsdl/mime/" targetNamespace="http://DbProgramming/NorthwindWebService" xmlns="http://schemas.xmlsoap.org/wsdl/"> ... type="s0:CustomersSoap">
- 7
- 382
- 0
Tài liệu Module 7: Building and Consuming a Web Service That Uses ADO.NET ppt
Ngày tải lên :
10/12/2013, 16:15
... a Web service that returns data ! Consume a Web service Module 7: Building and Consuming a Web Service That Uses ADO.NET What Is a Web Service? ! Programmable logic accessible through standard ... your class ! What are some other ways that you could fill the local DataSet with data other than by using a DataAdapter? ! What is the purpose of creating an empty, local instance of a DataSet? ... accidentally swapped the DataSet and DataAdapter, giving a compile error; for example, ds.Fill(da.tablename) is wrong Solution Swap the DataSet and DataAdapter references ! Problem A new employee started...
- 34
- 583
- 0
Tài liệu Using a Web Service doc
Ngày tải lên :
14/12/2013, 22:15
... creates an object named myCustomersService to call your Web service, and displays the returned results from the RetrieveCustomers() method in customersDataGrid Compile and run your Windows application ... myCustomersService.RetrieveCustomers(whereClauseTextBox.Text); customersDataGrid.DataMember = "Customers"; Note Once again, if your Web service is not deployed on the local computer, then replace localhost in this code with the name ... Northwind Web Service You can view the WSDL file for your Web service by clicking the Service Description link, and you can test your Web service by clicking the Retrieve Customers link Click the Add...
- 3
- 384
- 0
Tài liệu Updating Server Data Using a Web Service pptx
Ngày tải lên :
24/12/2013, 05:15
... ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.FillSchema(orderDetailTable, SchemaType.Source); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); ... ORDERS_ORDERDETAILS_RELATION = "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet ... [WebMethod] public bool UpdateOrders(DataSet ds) { // Create the DataAdapters for order and order details tables SqlDataAdapter daOrders = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]);...
- 6
- 414
- 0
Tài liệu Using a Web Service as a Data Source pdf
Ngày tải lên :
21/01/2014, 11:20
... "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT ... OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); ... ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable);...
- 4
- 369
- 0
Tài liệu Updating Server Data Using a Web Service ppt
Ngày tải lên :
26/01/2014, 10:20
... ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.FillSchema(orderDetailTable, SchemaType.Source); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); ... ORDERS_ORDERDETAILS_RELATION = "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet ... [WebMethod] public bool UpdateOrders(DataSet ds) { // Create the DataAdapters for order and order details tables SqlDataAdapter daOrders = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]);...
- 6
- 318
- 0
Báo cáo hóa học: " Dereverberation and denoising based on generalized spectral subtraction by multi-channel LMS algorithm using a small-scale microphone array" potx
Ngày tải lên :
21/06/2014, 19:20
... reverberation windows between and 10 did not vary greatly and was significantly better than the baseline We analyzed the influence of the number of channels on parameter estimation and delay -and- sum ... K Itou, M Yamamoto, K Takeda, T Takezawa, T Matsuoka, T Kobayashi, K Shikano, S Itahashi, JNAS: Japanese speech corpus for large vocabulary continuous speech recognition research J Acoust Soc ... reverberant speech at SNRs of 15, 20, 25, and 30 dB The noise overestimation factors a1 and a2 and the spectral floor parameters b1 and b2 in Eqs (25) and (26) were experimentally determined as 0.07,...
- 11
- 354
- 0
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
Ngày tải lên :
25/10/2012, 10:35
... data thereafter Data analysis and statistics Descriptive data are presented as raw numbers and as a percentage of overall cases or events Data on adverse events (ICU admission due to ward CA and ... ANZICS Database Management Committee: Development and implementation of a high-quality clinical database: the Australian and New Zealand Intensive Care Society Adult Patient Database J Crit Care ... comparison was performed for hospitals that had not introduced an MET service using the first year of data as baseline and the second year as comparator Finally, an additional and similar analysis was...
- 8
- 639
- 0
Creating a Web Service
Ngày tải lên :
28/10/2013, 19:15
... mySqlConnection.CreateCommand(); mySqlCommand.CommandText = selectString; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); ... http://DbProgramming/NorthwindWebService: [WebService(Namespace="http://DbProgramming/NorthwindWebService")] public class Customers : System .Web. Services.WebService Notice that you set the Namespace in a ... System.Data.SqlClient; By default, a Web service uses a namespace of http://tempuri.org, and you should change that to the URL used by your organization The following example sets the namespace for the Web service...
- 5
- 361
- 0
Registering a Web Service
Ngày tải lên :
07/11/2013, 15:15
... Logging in using a Microsoft Passport account Note If you don't have a Passport account, click the Get One Now link and sign up for a Passport account Enter your email address, name, and phone number ... your email address, name, and phone number Read the Terms Of Use page and click Accept if you want to continue Figure 17.16: The terms of use page Enter your business name and an optional description ... and click Submit to continue Make sure your organization is selected, and click Submit to continue Next, enter the details for your Web service Enter a name for your Web service, along with a...
- 5
- 301
- 0
Tài liệu Lab 1.1.7 Using ping and tracert from a Workstation ppt
Ngày tải lên :
11/12/2013, 13:15
... Step 12 Trace a local host name or IP address Try using the tracert command with a local host name or IP address It should not take long because the trace does not pass through any routers ... a point where one network connects to another network and the packet was forwarded through Step 11 Trace other IP addresses or domain names Try tracert on other domain names or IP addresses and ... server was able to resolve the name to an IP address Then there are listings of all routers the tracert requests had to pass through to get to the destination tracert uses the same echo requests and...
- 5
- 500
- 1