0

a molecular mechanism of ethanol dependence the influence of the ionotropic glutamate receptor

Báo cáo khoa học: Transthyretin and familial amyloidotic polyneuropathy Recent progress in understanding the molecular mechanism of neurodegeneration pdf

Báo cáo khoa học: Transthyretin and familial amyloidotic polyneuropathy Recent progress in understanding the molecular mechanism of neurodegeneration pdf

Báo cáo khoa học

... Nakazato M, Kangawa K, Minamino N, Tawara S, Matsuo H & Araki S (1984) Identification of a prealbumin variant in the serum of a Japanese patient with familial amyloidotic polyneuropathy Biochem ... Tanaka M, Hirai S, Matsubara E, Okamoto K, Morimatsu M & Nakazato M (1988) Familial amyloidotic polyneuropathy without familial occurrence: carrier detection by the radioimmunoassay of variant ... with carpal tunnel syndrome and a new transthyretin mutation, asparagine 70 Neurology 42, 2094–2102 26 Murakami T, Tachibana S, Endo Y, Kawai R, Hara M, Tanase S & Ando M (1994) Familial carpal...
  • 14
  • 488
  • 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học

... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – + – 0.25 1.5 p=0.01 60_HI 60M_HI Fig The ... (IDT, Coralville, IA, USA) In addition, oligonucleotides, namely AGAGACATG (P2), AAGGACATG (P3), AAATACATG (P4), AAAGCCATG (P5), AA AGAGATG (P6), AAAGACCTG (P7), AAAGACACG 3896 Cloning of the Hippi...
  • 14
  • 393
  • 0
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo khoa học

... whether RA modulates the activities of the enzymes that affect nuclear translocation and transcriptional activity of NFAT The NFAT proteins regulate the expression of FasL and a discrete set of ... inhibits the DNA binding activity of NFAT To understand the molecular mechanism of RA-induced inhibition of NFAT activity, we investigated whether the DNA-binding activity of NFAT was changed by RA ... lM, and NFAT binding was abolished in the presence of 1.0 lM all-trans-RA In contrast, SP-1 binding was similar at all concentrations of all-trans-RA tested All-trans-RA blocks NFAT translocation...
  • 9
  • 481
  • 0
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học

... accumulation of fat mass remains to be determined Available epidemiological data addressing the implication of PAH, in general, as a causal factor in the pathogeny of metabolic disorders are currently ... to calculate body fat and lean mass This has been shown to detect a range of 5–30% body fat mass with a correlation of 0.98 to values obtained by chemical analysis [49] The machine was calibrated ... stopped after 14 days of treatment The body weight of animals housed in pairs was monitored on a daily basis at 09.00, i.e immediately after the dark cycle Results are shown as the average weight gain...
  • 11
  • 424
  • 0
Báo cáo y học:

Báo cáo y học: "The molecular mechanism of osteoclastogenesis in rheumatoid arthritis" pptx

Báo cáo khoa học

... 43:250-258 36 Takayanagi H, Iizuka H, Juji T, Nakagawa T, Yamamoto A, Miyazaki T, Koshihara Y, Oda H, Nakamura K, Tanaka S: Involvement of receptor activator of nuclear factor κB ligand/osteoclast differentiation ... Kotake S, Udagawa N, Hakoda M, Mogi M, Yano K, Tsuda E, Takahashi K, Furuya T, Ishiyama S, Kim KJ, Saito S, Nishikawa T, Takahashi N, Togari A, Tomatsu T, Suda T, Kamatani N: Activated human ... Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N, Takahashi N, Suda T: Osteoclast differentiation factor...
  • 9
  • 489
  • 0
NVESTIGATING THE MOLECULAR MECHANISM OF PHOSPHOLAMBAN REGULATION OF THE Ca2+-PUMP OF CARDIAC SARCOPLASMIC RETICULUM

NVESTIGATING THE MOLECULAR MECHANISM OF PHOSPHOLAMBAN REGULATION OF THE Ca2+-PUMP OF CARDIAC SARCOPLASMIC RETICULUM

Y khoa - Dược

... elucidating the molecular mechanism of PLB action D THE MECHANISM OF Ca2+ TRANSPORT BY SERCA 2a SERCA is a large protein of nearly 1000 amino acids that actively transports Ca2+ into the lumen of the ... regulated via the β1-adrenergic receptor signaling pathway Catecholamine activation of the β -receptor results in GS-mediated activation of adenylate cyclase (AC) AC converts ATP to cAMP, and activates ... with half-maximal activation of Ca2+-ATPase activity occurring at 0.16 µM Ca2+ (KCa = 0.16 µM), and maximal enzyme activity reached at the saturating Ca2+ concentration of 1-2 µM (Fig 4A and Table...
  • 86
  • 153
  • 0
The Molecular Mechanism of Break Induced Replication

The Molecular Mechanism of Break Induced Replication

Y khoa - Dược

...   Database   Name           OL1718   ATGTCGAGGGAGTCGAACGACACAATACAGAGCG   ATACGGTTAGATCATCCTCTAAATCAG     ACTATTTTAGAATCCAGCTAagaggatccccgggaattca     OL1198   GATATGACCCTGTCAAACAACTTTGA     OL1196 ...  LC:  ura3-­‐29  sequence     OL1518   ATATTTGCTGCTATACTACCAAATGGAAAAATATAAGATAC   P2  to  amplify  and  insert  ura3-­‐29  into  intergenic       ACAATATAGATAGTATTAAAAAAACGTGTATACGTTATT   region ... TTATTCTAAGATGTGGTCTTCGGTATCCTGACCA   P1  to  amplify  pif1::BSD  fragment       CGAGGTTCGTCGGAAACCAATGAATGA       ACTTGATTACTATTAGACTCgcgatatcgctagctcgagc         OL1720   ATGCCAAAGTGGATAAGATCAACATTGAATCATAT   P2  to  amplify...
  • 152
  • 374
  • 0
UNDERSTANDING THE MOLECULAR MECHANISM OF CENTRINS IN TRYPANOSOMA BRUCEI

UNDERSTANDING THE MOLECULAR MECHANISM OF CENTRINS IN TRYPANOSOMA BRUCEI

Cao đẳng - Đại học

... Trypanosoma brucei, a parasite causing trypanosomiasis Trypanosoma brucei, a unicellular parasite, is the causative agent of sleeping sickness in humans and nagana in livestock The trypanosomiasis ... infraciliary lattice (ICL) of Parmecium (Allen et al., 1998), the cytopharyngeal apparatus of the ciliates Nassula and Furgasonia (Vigues et al., 1999), the rhizoplast in Platymonas subcordiformis (Salisbury ... DNA polymerase (Pfu DNA Polymerase, Taq DNA polymerase or Advantage polymerase), 10×reaction buffer, appropriate amount of MgCl2 according to instruction manual of polymerase that was used, and...
  • 125
  • 605
  • 0
Investigating the molecular mechanism of ERp29 regulated cell cycle arrest in breast cancer

Investigating the molecular mechanism of ERp29 regulated cell cycle arrest in breast cancer

Cao đẳng - Đại học

... therapy, chemotherapy, and targeted therapy Surgery is often combined with other treatment such as radiation therapy or chemotherapy Surgery and radiation therapy are types of local therapy They remove ... mRNA The spliced mRNA is then ligated and encodes an activator of UPR target genes Secondly, the activation of ATF6 leads to its transportation from the ER to the Golgi apparatus, and its cleavage ... the body For stage metastatic cancer, surgery, radiation therapy, chemotherapy, and targeted therapies are combined to manage the disease Table Treatment of breast cancer Content was sourced from...
  • 89
  • 277
  • 0
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Báo cáo khoa học

... and radiographic examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles from the experimental joints was examined to assess any macroscopic ... inhibits articular chondrocyte death A A B B Fig Evaluation of articular cartilage after experimentally induced osteoarthritis (A) Photomicrographs of articular cartilage (B) The evaluation of osteoarthritis ... pressure was applied to the medial side of the straight patellar ligament A 21-gauge spinal needle was inserted through the fat pad into the intercondylar space lateral to the straight patellar ligament...
  • 11
  • 461
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Báo cáo khoa học

... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC GCGGGATCCCGCAGGGTGAACTCTGCCTCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCCCCCTGCCGAAGTGGACCCT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT...
  • 14
  • 517
  • 0
Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

Báo cáo khoa học

... providing a significant amount of the Xa–VIIa–TF complex The mathematical model has shown that the analysis of the inhibition curves of the Scheme A development of Scheme by addition of the reaction of ... on the kinetics of factor X activation in the absence of factor Xa at the initiation point of the reaction Yet this mechanism based on the hypothesis of the interaction between TFPI and Xa–VIIa–TF ... though it is clear that the apparent values of kcat and Km may have a more sophisticated interpretation than the constants in the classical scheme of Michaelis This approach was used in the present...
  • 16
  • 415
  • 0
Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc

Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc

Báo cáo khoa học

... on the concentration of the substrate glutamate was examined In these experiments a fixed concentration of NADP+ of 250 lM was used and the Ki for zinc was determined at a series of fixed glutamate ... relative quantitation was achieved using the ratio of the height of the emerging peak to that of the undigested GDH For MALDI-TOF calibration purposes, BSA was used as a standard and was diluted ... of the peaks, in the presence of zinc the 3446 and 4089 peak appear significantly faster in the digestion while the peak at 34 645 appears a little faster than in the absence of zinc The various...
  • 12
  • 544
  • 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Báo cáo khoa học

... diverse glutamate receptor subtypes, namely the ionotropic N-methyl-d-aspartate (NMDA) and kainate receptors and the metabotropic glutamate (mGlu) receptors, lead to NF-jB activation Ca2+ signalling ... ‘classic’ pathway and the ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localization of NF-jB [7] The canonical pathway of NF-jB 28 activation ... DNA and export the complex back to the cytoplasm, therefore providing a feedback mechanism to restore the original latent state Two different intracellular pathways activate NF-jB, namely the...
  • 9
  • 527
  • 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học

... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively cells ... antisense hRhoA sense hRhoA antisense GAPDH-F GAPDH-R Sequence (5¢- to 3¢) GGGATCAGAGTTCATAGTGAAAAGAG GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTC GCGGGTACCAATGTGATGGGTGGACTGGT GCGAAGCTTACCAGACCGTGGACTAACGA ... studied the role of Smad proteins in regulation of the RhoA ⁄ B genes, activation of these small GTPases and the induction of actin reorganization Finally, to address the biological significance of the...
  • 14
  • 420
  • 0
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx

Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx

Báo cáo khoa học

... oligonucleotides 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT CACCTCTCTTGAGTTGC-3¢) was ligated to complete the construction up to amino acid R833 of wild ... in the membrane preparation, as measured using a gamma counter Membrane preparations were then used in guanylyl cyclase assays A total of lg of membranes was incubated for 12 at 37 °C in the ... of adenosine 5¢-triphosphate in the activation of membrane-bound guanylate cyclase by the atrial natriuretic factor FEBS Lett 219, 375–379 21 Marala RB, Sitaramayya A & Sharma RK (1991) Dual...
  • 12
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: "Apolipoprotein A-I infiltration in rheumatoid arthritis synovial tissue: a control mechanism of cytokine production" pot

Báo cáo khoa học

... and macrophages accumulate The localization of positive acutephase proteins, such as CRP and A- SAA, was different from that of apoA-I: only faint staining, limited to vascular endothelium, was ... apoA-I concentration in plasma [14] These studies suggest that variations of apoA-I levels may inversely correlate with disease activity The observation that apoA-I can infiltrate and be retained ... Denmark), at 1/50 dilution; and anti-acute-phase serum amyloid A (A- SAA) (gift from Dr AS Whitehead, Philadelphia, PA, USA), at 1/1200 Isotype-matched murine IgG1 (DAKO) was used at the same...
  • 4
  • 290
  • 0
Báo cáo y học:

Báo cáo y học: "Platelet-derived exosomes induce endothelial cell apoptosis through peroxynitrite generation: experimental evidence for a novel mechanism of septic vascular dysfunction" pot

Báo cáo khoa học

... Diverging from the idea of an accidental membrane fragmentation or from the apoptosis-associated bubbling of the plasma membrane, evidence accumulated during the past years has revealed a very specific ... in cardiovascular homeostasis, the mechanisms underlying endothelial activation and the development of endothelial dysfunction are of great interest A large body of evidence indicates that the ... the group of M.Z Ratajczak demonstrated that platelet microparticles could activate intracellular signaling pathways such as ERK and Akt, inducing angiogenesis and metastasis in lung cancer and...
  • 12
  • 290
  • 0
Molecular mechanism of self renewal exit during endothelial differentiation

Molecular mechanism of self renewal exit during endothelial differentiation

Cao đẳng - Đại học

... et al., 2000; Takahashi et al., 2000) It has been proposed that the FATC and FAT domains interact to yield a configuration that exposes the catalytic domain mTOR also contains a putative negative ... transcriptional and translational regulation But how exactly ES cells fulfil self-renewal through activation of PI3K pathway? In other words, what are downstream targets of the PI3K pathway that ... play a critical role in the maintenance and repair of tissue repair After injury either by trauma or disease, vascular repair and regeneration constitutes a critical component of the healing process...
  • 182
  • 184
  • 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Báo cáo khoa học

... (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA ... partially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ ... to a monochromator (Spectramaster) and a 12/14 bit frame transfert rate digital camera (Astrocam) MERLIN software was also used to calculate the 340/380 fluorescence ratio (Rf) The intensity of...
  • 11
  • 506
  • 0

Xem thêm