... Nakazato M, Kangawa K, Minamino N, Tawara S, Matsuo H & Araki S (1984) Identification ofa prealbumin variant in the serum ofa Japanese patient with familial amyloidotic polyneuropathy Biochem ... Tanaka M, Hirai S, Matsubara E, Okamoto K, Morimatsu M & Nakazato M (1988) Familial amyloidotic polyneuropathy without familial occurrence: carrier detection by the radioimmunoassay of variant ... with carpal tunnel syndrome and a new transthyretin mutation, asparagine 70 Neurology 42, 2094–2102 26 Murakami T, Tachibana S, Endo Y, Kawai R, Hara M, Tanase S & Ando M (1994) Familial carpal...
... whether RA modulates the activities ofthe enzymes that affect nuclear translocation and transcriptional activity of NFAT The NFAT proteins regulate the expression of FasL and a discrete set of ... inhibits the DNA binding activity of NFAT To understand themolecularmechanismof RA-induced inhibition of NFAT activity, we investigated whether the DNA-binding activity of NFAT was changed by RA ... lM, and NFAT binding was abolished in the presence of 1.0 lM all-trans-RA In contrast, SP-1 binding was similar at all concentrations of all-trans-RA tested All-trans-RA blocks NFAT translocation...
... accumulation of fat mass remains to be determined Available epidemiological data addressing the implication of PAH, in general, as a causal factor in the pathogeny of metabolic disorders are currently ... to calculate body fat and lean mass This has been shown to detect a range of 5–30% body fat mass with a correlation of 0.98 to values obtained by chemical analysis [49] The machine was calibrated ... stopped after 14 days of treatment The body weight of animals housed in pairs was monitored on a daily basis at 09.00, i.e immediately after the dark cycle Results are shown as the average weight gain...
... 43:250-258 36 Takayanagi H, Iizuka H, Juji T, Nakagawa T, Yamamoto A, Miyazaki T, Koshihara Y, Oda H, Nakamura K, Tanaka S: Involvement ofreceptor activator of nuclear factor κB ligand/osteoclast differentiation ... Kotake S, Udagawa N, Hakoda M, Mogi M, Yano K, Tsuda E, Takahashi K, Furuya T, Ishiyama S, Kim KJ, Saito S, Nishikawa T, Takahashi N, Togari A, Tomatsu T, Suda T, Kamatani N: Activated human ... Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N, Takahashi N, Suda T: Osteoclast differentiation factor...
... elucidating themolecularmechanismof PLB action D THEMECHANISMOF Ca2+ TRANSPORT BY SERCA 2a SERCA is a large protein of nearly 1000 amino acids that actively transports Ca2+ into the lumen ofthe ... regulated via the β1-adrenergic receptor signaling pathway Catecholamine activation ofthe β -receptor results in GS-mediated activation of adenylate cyclase (AC) AC converts ATP to cAMP, and activates ... with half-maximal activation of Ca2+-ATPase activity occurring at 0.16 µM Ca2+ (KCa = 0.16 µM), and maximal enzyme activity reached at the saturating Ca2+ concentration of 1-2 µM (Fig 4A and Table...
... Database Name OL1718 ATGTCGAGGGAGTCGAACGACACAATACAGAGCG ATACGGTTAGATCATCCTCTAAATCAG ACTATTTTAGAATCCAGCTAagaggatccccgggaattca OL1198 GATATGACCCTGTCAAACAACTTTGA OL1196 ... LC: ura3-‐29 sequence OL1518 ATATTTGCTGCTATACTACCAAATGGAAAAATATAAGATAC P2 to amplify and insert ura3-‐29 into intergenic ACAATATAGATAGTATTAAAAAAACGTGTATACGTTATT region ... TTATTCTAAGATGTGGTCTTCGGTATCCTGACCA P1 to amplify pif1::BSD fragment CGAGGTTCGTCGGAAACCAATGAATGA ACTTGATTACTATTAGACTCgcgatatcgctagctcgagc OL1720 ATGCCAAAGTGGATAAGATCAACATTGAATCATAT P2 to amplify...
... Trypanosoma brucei, a parasite causing trypanosomiasis Trypanosoma brucei, a unicellular parasite, is the causative agent of sleeping sickness in humans and nagana in livestock The trypanosomiasis ... infraciliary lattice (ICL) of Parmecium (Allen et al., 1998), the cytopharyngeal apparatus ofthe ciliates Nassula and Furgasonia (Vigues et al., 1999), the rhizoplast in Platymonas subcordiformis (Salisbury ... DNA polymerase (Pfu DNA Polymerase, Taq DNA polymerase or Advantage polymerase), 10×reaction buffer, appropriate amount of MgCl2 according to instruction manual of polymerase that was used, and...
... therapy, chemotherapy, and targeted therapy Surgery is often combined with other treatment such as radiation therapy or chemotherapy Surgery and radiation therapy are types of local therapy They remove ... mRNA The spliced mRNA is then ligated and encodes an activator of UPR target genes Secondly, the activation of ATF6 leads to its transportation from the ER to the Golgi apparatus, and its cleavage ... the body For stage metastatic cancer, surgery, radiation therapy, chemotherapy, and targeted therapies are combined to manage the disease Table Treatment of breast cancer Content was sourced from...
... and radiographic examination ofthe articular cartilage after experimentally induced OA Articular cartilage ofthe femoral condyles from the experimental joints was examined to assess any macroscopic ... inhibits articular chondrocyte death AA B B Fig Evaluation of articular cartilage after experimentally induced osteoarthritis (A) Photomicrographs of articular cartilage (B) The evaluation of osteoarthritis ... pressure was applied to the medial side ofthe straight patellar ligament A 21-gauge spinal needle was inserted through the fat pad into the intercondylar space lateral to the straight patellar ligament...
... providing a significant amount ofthe Xa–VIIa–TF complex The mathematical model has shown that the analysis ofthe inhibition curves ofthe Scheme A development of Scheme by addition ofthe reaction of ... on the kinetics of factor X activation in the absence of factor Xa at the initiation point ofthe reaction Yet this mechanism based on the hypothesis ofthe interaction between TFPI and Xa–VIIa–TF ... though it is clear that the apparent values of kcat and Km may have a more sophisticated interpretation than the constants in the classical scheme of Michaelis This approach was used in the present...
... on the concentration ofthe substrate glutamate was examined In these experiments a fixed concentration of NADP+ of 250 lM was used and the Ki for zinc was determined at a series of fixed glutamate ... relative quantitation was achieved using the ratio ofthe height ofthe emerging peak to that ofthe undigested GDH For MALDI-TOF calibration purposes, BSA was used as a standard and was diluted ... ofthe peaks, in the presence of zinc the 3446 and 4089 peak appear significantly faster in the digestion while the peak at 34 645 appears a little faster than in the absence of zinc The various...
... diverse glutamatereceptor subtypes, namely theionotropic N-methyl-d-aspartate (NMDA) and kainate receptors and the metabotropic glutamate (mGlu) receptors, lead to NF-jB activation Ca2+ signalling ... ‘classic’ pathway and the ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localization of NF-jB [7] The canonical pathway of NF-jB 28 activation ... DNA and export the complex back to the cytoplasm, therefore providing a feedback mechanism to restore the original latent state Two different intracellular pathways activate NF-jB, namely the...
... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively cells ... antisense hRhoA sense hRhoA antisense GAPDH-F GAPDH-R Sequence (5¢- to 3¢) GGGATCAGAGTTCATAGTGAAAAGAG GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTC GCGGGTACCAATGTGATGGGTGGACTGGT GCGAAGCTTACCAGACCGTGGACTAACGA ... studied the role of Smad proteins in regulation ofthe RhoA ⁄ B genes, activation of these small GTPases and the induction of actin reorganization Finally, to address the biological significance of the...
... oligonucleotides 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT CACCTCTCTTGAGTTGC-3¢) was ligated to complete the construction up to amino acid R833 of wild ... in the membrane preparation, as measured using a gamma counter Membrane preparations were then used in guanylyl cyclase assays A total of lg of membranes was incubated for 12 at 37 °C in the ... of adenosine 5¢-triphosphate in the activation of membrane-bound guanylate cyclase by the atrial natriuretic factor FEBS Lett 219, 375–379 21 Marala RB, Sitaramayya A & Sharma RK (1991) Dual...
... and macrophages accumulate The localization of positive acutephase proteins, such as CRP and A- SAA, was different from that of apoA-I: only faint staining, limited to vascular endothelium, was ... apoA-I concentration in plasma [14] These studies suggest that variations of apoA-I levels may inversely correlate with disease activity The observation that apoA-I can infiltrate and be retained ... Denmark), at 1/50 dilution; and anti-acute-phase serum amyloid A (A- SAA) (gift from Dr AS Whitehead, Philadelphia, PA, USA), at 1/1200 Isotype-matched murine IgG1 (DAKO) was used at the same...
... Diverging from the idea of an accidental membrane fragmentation or from the apoptosis-associated bubbling ofthe plasma membrane, evidence accumulated during the past years has revealed a very specific ... in cardiovascular homeostasis, the mechanisms underlying endothelial activation and the development of endothelial dysfunction are of great interest A large body of evidence indicates that the ... the group of M.Z Ratajczak demonstrated that platelet microparticles could activate intracellular signaling pathways such as ERK and Akt, inducing angiogenesis and metastasis in lung cancer and...
... et al., 2000; Takahashi et al., 2000) It has been proposed that the FATC and FAT domains interact to yield a configuration that exposes the catalytic domain mTOR also contains a putative negative ... transcriptional and translational regulation But how exactly ES cells fulfil self-renewal through activation of PI3K pathway? In other words, what are downstream targets ofthe PI3K pathway that ... play a critical role in the maintenance and repair of tissue repair After injury either by trauma or disease, vascular repair and regeneration constitutes a critical component ofthe healing process...
... (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA ... partially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ ... to a monochromator (Spectramaster) and a 12/14 bit frame transfert rate digital camera (Astrocam) MERLIN software was also used to calculate the 340/380 fluorescence ratio (Rf) The intensity of...