a model system that allows in vivo manipulation and study of epithelial cell polarity
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
... Acta Veterinaria Scandinavica 2008, 50:27 Introduction Human and canine malignant mammary tumors share some epidemiological and clinicopathological features Incidence in both species increases ... Veterinaria Scandinavica 2008, 50:27 http://www.actavetscand.com/content/50/1/27 Patients were evaluated by clinical history and physical examination including mammary tumor measurement and inguinal ... emphasize that an ex -vivo model of tissue slice culture, where epithelial- mesenchymal interactions are maintained, may add information to a model where isolated cells are cultured In addition, an...
- 9
- 337
- 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt
... b-hexosaminidase is in uenced by SG Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after days of culture, and reached a ... similar kinetics as in SG+ ⁄ + cells In contrast, the total amounts of CPA antigen (pro-CPA + mature CPA) were approximately equal in SG– ⁄ – and SG+ ⁄ + cells An interesting observation was that only ... immunoblot analysis using antisera towards carboxypeptidase A (CPA) and mouse mast cell protease (mMCP)-6 Note the increase in extracellular mMCP-6 and CPA antigen, in both SG+ ⁄ + and SG– ⁄ –...
- 12
- 438
- 0
Báo cáo y học: "A quantitative evaluation of gross versus histologic neuroma formation in a rabbit forelimb amputation model: potential implications for the operative treatment and study of neuromas" ppt
... nociceptive pathways Amir and Devor showed in a rat sciatic neuroma model that spontaneous discharges occurred in afferents that terminated in the neuroma, as well as in afferents that had emitted ... significant differences in the median, radial, and ulnar neuromas in terms of myelinated axon counts at a distance of 15 mm proximally However, it is important to note that whereas Scadding and Thomas ... fashion was not evaluated Using a mouse sural nerve model, Scadding and Thomas demonstrated a 37% increase in myelinated axons at a distance of 1.5 cm proximal to the point of nerve section after...
- 10
- 433
- 0
How to setup a Linux system that can boot directly from a software RAID
... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... boot loader: Once the configuration installation options are provides, the installation of the system starts: Notice that while the system is installing, the software RAID transparently initializes ... the partitioning utility to create the software RAID partitions In the example both disks are split into a 3498Mb and a 596Mb software RAID partitions: Device Type Size Mbytes /dev/hda1 software...
- 14
- 567
- 1
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc
... and may be set between and 30 Communications with the SR830 uses ASCII characters Commands may be in either upper or lower case and may contain any number of embedded space characters A command ... consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 character input buffer and processes commands in the order received Similarly, ... Binh, Nguyen Anh Tuan, Nguyen Huy Binh excitation Our new spectrometry system shows many advantages for studying Raman and Fluorescence spectra as well as weak optical signal spectra in general...
- 6
- 524
- 0
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast ... separating gel consisted of a 4–13% (w/v) acrylamide gradient whereas the stacking gel was 4% (w/v) acrylamide Final concentrations of Bistris and amino-ncaproic acid in gel buffer were 25 mM and ... mf2 and pmf2 cells grown in TAP medium, data are the mean of two to four independent cultures and SD are indicated; for the other strains only one determination was made Strains mf1 and mf2 are...
- 10
- 411
- 0
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... purification and characterization Chromosoma 102, 631–636 Mizushina, Y., Kamisuki, S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, ... 3¢-end-labeled with [a- 32P]ddATP, annealed to its complementary strand and treated with human AP endonuclease to release a dRP-containing substrate (Fig 4A) This substrate was incubated in the absence ... encode a predicted product of 552 amino acid residues with a molecular mass of 60.9 kDa OsPol k protein contains a BRCT domain at the N-terminus and a Pol X domain at the C-terminal region, similar...
- 9
- 492
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer pot
... et al (2005) A microRNA polycistron as a potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi ... this approach discriminates normal and neoplastic tissues in various cancer types, including CLL, breast cancer, glioblastoma, thyroid papillary carcinoma, hepatocellular carcinoma, lung cancer, ... (Loqs), a double-stranded RNA-binding-domain protein that is a homologue of the HIV transactivating response RNA-binding protein (TRBP) The functional strand of the miRNA duplex guides the RNA-induced...
- 8
- 432
- 0
Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx
... either an x or a y or a constant, and θ is a comparator (e.g., , ≥, =, =) In particular, each x and each y must appear at least once among the zs PANORAMA: A DATABASE SYSTEM THAT ANNOTATES ... intensional information in the database may suggest additional characterizations of the extensional answer If this intensional information is extracted, database values may gain additional meaning Thus, ... prevailing approach to access control in relational databases is to associate views with users The database system maintains a set of view definitions, a set of user names, and a set of pairs...
- 23
- 332
- 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt
... thrombin and PAI-1 These findings leave a role for TM open in altering the initial binding step between thrombin and PAI-1 or in changing the ability of thrombin to catalyze subsequent steps that are ... lLÆmin)1 Association and dissociation rate constants were determined from the SPR sensor grams by global nonlinear regression using the BIAEVALUATION software (BIAcore AB) Binding of various analytes ... TM at the same rate as in the absence of PAI-1 and no increase in surface-bound mass was observed as a result of PAI-1 binding to TM/thrombin complexes (Fig 3A) Also, no significant difference in...
- 10
- 483
- 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
... subunits, disassembly of transmembrane a helices, and a separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative ... Yokoyama, T., Kaya, S., Abe, K., Taniguchi, K., Katoh, T., Ê Yazawa, M., Hayashi, Y & Mardh, S (1999) Acid-labile ATP and/ or ADP/Pi binding to the tetraprotomeric form of Na/KATPase accompanying ... contact surfaces of proteins and water, and/ or protein and lipid bilayer: an increase in the thickness of the lipid bilayer partially covers the transmembrane proteins and, thus, decreases the water-soluble...
- 9
- 432
- 0
choosing a trading system that actually works
... drawdown risk and find it suitable, both financially and emotionally An inherent characteristic of investing in general and in trading systems in particular is the maximum drawdown in account value from ... slippage assumptions Commission and slippage can cause an otherwise winning performance to actually be a net loser Beware of any futures trading system performance data where commission and slippage ... primary way of evaluating a trading system is based on its historical back tested performance (“hypothetical performance”) But the performance record must include real world trading commission and...
- 5
- 261
- 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... characterization of panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’)2 fragments Panitumumab (Amgen) ... et al: Biodistribution and planar gamma camera imaging of I-123- and I131-labeled F(ab ‘)(2) and Fab fragments of monoclonal antibody 14C5 in nude mice bearing an A5 49 lung tumor Nuclear Medicine ... fragment is a good candidate for imaging Studies are continuing with the panitumumab F(ab’)2 to further evaluate the role of panitumumab F(ab’) in radiological imaging, SPECT and PET, and also...
- 15
- 452
- 0
Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps
... METHODS The models were tested with a data set containing 44 trees belonging to 13 good growing stands, sampled in the Landes de Gascogne area and aged more than 35 years to get the main part of the ... Nonlinear to assess the Our aim is to select a model to be used several data sets of individual height-age curves of maritime pines (Pinus pinaster Ait) aged between 20 and 80 years Most of the ... In order to detect and avoid these potential shortcomings, a preliminary investigation was carried out and is presented in this paper Different models and different parametrizations of the same...
- 10
- 280
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
... temperature and transpi- a crown ration rate; the resistance and capacitance of each compartment are independent of the flux or water potential of the compartment and remain constant during the day ... particular individuals in a stand Sap flow data have been used for estimating hourly transpiration and canopy conductances in a range of forest stands [1, 10, 13, 19, 20] The sap flow measurements can ... area in a stand to a high degree of accuracy Thus, application of this principle could therefore be questionable in the case of a heterogeneous stand Despite large scatter in the data, mainly caused...
- 18
- 406
- 0
báo cáo khoa học:" Numerical simulation of in vivo intraosseous torsional failure of a hollow-screw oral implant" pdf
... strain data obtained during the clinical test that yielded failure of the bone-implant interface was implemented in definition of loading conditions in the finite element analysis In the definition ... via couple of surgical (Institut Straumann) and rachet adapter (Institut Straumann), the strain-gauge signals were recorded by a data acquisition system (ESAM Traveller 1, Vishay Micromeasurements ... extensive breakdown of implant and teeth supported fixed prostheses that have been in functioning for years both in maxillary and mandibular partially edentulous arches In the maxilla, one-piece acrylic...
- 7
- 281
- 0
Báo cáo y học: " Involvement of TORC2, a CREB co-activator, in the in vivo-specific transcriptional control of HTLV-1" doc
... elongation factor (EF)-1α, 5'-TCTGGTTGGAATGGTGACAACATGC-3' and 5'-CCAGGAAGAGCTTCACTCAAAGCTT-3'; for GAPDH, 5'ACCACAGTCCATGCCATCAC-3' and 5'-TCCACCACCCTGTTGCTGTA-3'; for β-actin: 5'-GAGATCTGCCGATCCGCCGCCCG-3', ... Y, Yasunaga J, Nosaka K, Tanaka Y, Matsuoka M: Genetic and epigenetic inactivation of tax gene in adult T -cell leukemia cells Int J Cancer 2004, 109:559-567 Kannagi M, Harada S, Maruyama I, Inoko ... Expression and subcellular localization of TORC2 in EL4-Gax cells Expression and subcellular localization of TORC2 in EL4-Gax cells A Immunofluorescent staining of TORC2 protein (red) in EL4-Gax cells...
- 16
- 346
- 0
Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa
... 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' and :5'-CCCTGA CCAAGTATAGCTGTTCAGATCTTTAACTAAATGGTATTC C-3'; for stage 2, downstream mutagenesis, 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' and 5'-CAATGCAAGCTAGCGGGTAGATCTATACAGAGAATATGAGGGCG-3' ... and 3' ends of the 141 bp region that was to be deleted Mutagenesis was carried out as in two stages using the following primers: stage 1, upstream mutagenesis:- 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' ... signal may act as a subcellular localisatio signal as well as a high affinity binding site for Gag The resulting RNAprotein complex is then targeted to the plasma membrane where virion budding takes...
- 14
- 437
- 0
Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt
... sequencing several fold interactions Figure of Degree sampling of SILAC peptide pairs Degree of sampling of SILAC peptide pairs Yeast was SILAC labeled as explained in Figure and one gel band was analyzed ... than 4,500 yeast proteins, indicating that at least 80% of the yeast genome is expressed in logarithmically growing cells Using quantitative western blotting against the tandem affinity We failed ... that an increase of dynamic range by at least an order of magnitude should be achievable Conclusion Here we have shown that high mass accuracy and sequencing speeds employed in state of the art...
- 15
- 267
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... emerging model system for chemical testing that is attracting scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model ... Gene Marking Forward primer - actin Housekeeping gene CAGACATCAGGGAGTGATGG ef1α hsp70 foxd3 Housekeeping gene ACATGCTGGAGGCCAGCTC Stress indicator CCGAAGAGAAGCGACTTGAC Autonomic nervous CTTACCTTGGGTTGCTCCAG...
- 58
- 262
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25