a model for studying production of secondary metabolites
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral gene family ... collected, and an effort to make available sets of sequences for use as molecular markers for snakes (for example, microsatellite primers and orthologous loci for use in phylogenetics and other applications)...
- 8
- 410
- 0
Báo cáo khoa học: "A Model for Robust Processing of Spontaneous Speech by Integrating Viable Fragments*" ppt
... the parser has to simultaneously perform two tasks: Searching for a path to be analysed and analysing it as well If the analysis procedure is too liberal, it may already accept and analyse an ungrammatical ... semantic predicates, a list of scopal constraints, syntactic, prosodic and pragmatic information as well as tense and aspect and sortal information An example of a VIT for the sentence Montag ist gut ... length and coverage of the individual analyses The length is defined as the length of the temporal interval an analysis spans; an analysis with a greater length is preferred The coverage of an analysis...
- 5
- 426
- 0
e-Parliament to e-Democracy Creating a Model for Effective Management of Public Content
... http://scholar.sun.ac.za democracy, can help parliaments to become more transparent, accessible, accountable and effective in promoting democracy e-Parliament enables automation of parliamentary information ... many parliaments lack a strategic plan, an adequate ICT infrastructure, basic tools for Members of Parliament and staff, systems for managing documents and trained ICT staff The status of the ... virtual forums for debate, can provide a platform for freedom of speech and a channel through which representatives can be contacted, engaged with and influenced As yet this form of e-democracy has...
- 171
- 421
- 0
Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot
... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric ... conceptualization has also been used to develop a five-compartment anatomical model (brain, liver, kidney, heart and all other organs) as an explanation for Kleiber's law [28] The anatomical con- Page ... midpoint of the values of ki plus the midpoint of the values of bi because values of ki are not available for certain tissues For scaling of the brain and the epithelial tissues of the skin and gastrointestinal...
- 8
- 356
- 0
Relevance of mineral nutrition and light quality for the accumulation of secondary metabolites in centella asiatica and hydrocotyle leucocephala
... S., Gautam, A. , Sahrma, A. , Batra, A. , 2010 Centella asiatica (L.): a plant with immense medicinal potential but threatened International Journal of Pharmaceutical Sciences Review and Research ... compounds of asiaticoside and asiatic acid (Sigma Aldrich, St Louis, Missouri, USA) and are in agreement with published data (Mauri and Pietta, 2000; Rafamantanana et al., 2009) The concentrations of ... and light quality on the accumulation of pharmaceutically relevant secondary metabolites, particularly saponins and lignans, using Centella asiatica and Hydrocotyle leucocephala as examples Experiments...
- 149
- 319
- 0
A model for the prediction of subgrade soil resilient modulus for flexible pavement design
... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... the subgrade Among these material properties, those associated with asphalt concrete and subgrades are known to fluctuate seasonally Therefore seasonal evaluation of pavement material properties ... Strategic Highway Research Program (SHRP) through United States and Canadian pavement data base (DataPave online version release-18, 2004;http://www.datapave.com) Secondly, statistical and probabilistic...
- 104
- 423
- 0
Analysis and practical implementation of a model for combined growth and metabolite production of lactic acid bacteria
... accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of [LaH] and pH at each time point during growth is necessary According ... Nicolaı ¨ et al (1993) Nicolaı et al (1993) have constructed a dynamic ¨ model for the surface growth of lactic acid bacteria on vacuum-packed meats In the current research, the model is adapted ... medium and associated initial pH is not a variable in the case study presented in this paper, lmax and pmax can be reasonably assumed constant Among microbiologists it is widely accepted that metabolites...
- 12
- 625
- 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...
- 19
- 317
- 0
Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx
... use of these underestimated bacterial aggregates as intriguing models for the analysis of protein–protein interactions in the context of amyloid and prion diseases Dynamics of IB formation and ... amyloid formation pathways, any sequence able to be accommodated in a b-sheet conformation can, potentially, reach the amyloid state [51,56] Amyloid-like properties of bacterial IBs Protein aggregation ... E Garc a- Fruitos et al Biological role of bacterial inclusion bodies A B Fig A nucleation ⁄ polymerization selfassembly process drives the formation of IBs in bacteria (A) In vivo formation of...
- 9
- 432
- 0
Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx
... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... International Conference on Computational Linguistics, pp.218-224 COLING-ACL’98 Lance A Ramshaw and Michael P Marcus ( In Press) Text chunking using transformation-based learning In Natural Language ... sequences, parameters (3) and (4) can be calculated, The calculation formulas are similar with equations (13) and (14) respectively Before training trigram model (3), all possible baseNP rules...
- 8
- 482
- 0
Blackwell Science, Ltd Group breeding dramatically increases reproductive success of yearling but not older female scrubwrens: a model for cooperatively breeding birds? ppt
... occupy an area of 40 ha, of which 27 are planted with native Australian plants Most of the remainder is natural woodland, which is contiguous with the woodland of Canberra Nature Park The birds are ... was used on group size and territory quality (categorical variables), and male age and age squared (continuous variables) Age and age-squared were used in case the effect of male age was not a ... natal philopatry of males, although occasionally males immigrate into groups as subordinates ( Magrath & Whittingham 1997) Females always disperse from their natal group before or at the onset of...
- 16
- 337
- 0
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC GGT GAT ... Genomics) for running many of the analytical ultracentrifugation samples, A Padovani for making the W56F variant and J A Kornblatt for encouragement and advice Financial support was provided by the Natural ... temperature denaturation, any change at these positions was destabilizing G37 6A and G376E had identical Tm values At position 157, alanine had a smaller effect than aspartate, but even alanine decreased...
- 10
- 520
- 0
Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx
... designated as a a, head±tail, and b±b The a a dimer has a diad and is characterized as helix-helix packing between the two monomers, as shown in Fig 2A The head±tail dimer is formed by a crystallographic ... (1993) Interaction between staphylokinase, plasmin(ogen), and alpha2-antiplasmin Recycling of staphylokinase after neutralization of the plasmin-staphylokinase complex by alpha2-antiplasmin J Biol ... 1.4 A added to the van der Waals radius Dimer model Buried surface Ê area (A2 ) Hydrogen bonds Salt bridges A 77Arg A 65Glu A 65Glu A 61Glu A 58Glu None P212121 a a 1009 A 65Glu OE1±B 62Tyr OH, A...
- 7
- 389
- 0
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx
... neither photoaf®nity labeled by a dioxin analog, nor activated by b-naphto¯avone in a yeast system [20]; the rainbow trout AhRa that binds TCDD [21] and the Microgadus Tomcod AhR also activated by ... 13 Altschul, S.F., Madden, T.L., Schaer, A. A., Zhang, J., Zhang, Z., È Miller, W & Lipman, D.J (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs Nucleic Acids ... RESULTS AND DISCUSSION Structure prediction Application of a recursive PSI-BLAST [13] search (default parameters) against the nonredundant protein sequence database revealed a high number of matches...
- 6
- 569
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... observed values of various wave characteristics, it can be remarked that the numerical model can simulate wave transformation in the nearshore region with an acceptable accuracy. ... the coastal structures. Zero gradients of k and ε are assumed at the offshore, lateral boundaries and at surfaces of coastal structures. A scheme similar to that of Hibberd ... the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in the nearshore area obtained by Ting and Kirby [15‐17] are used. ...
- 11
- 460
- 0
THE REFORM OF THE SAVINGS BANK SYSTEM IN FRANCE – A MODEL FOR OTHER COUNTRIES? docx
... The associative tasks are carried out centrally by a national association of the savings banks In addition, the savings bank group consists of around 450 local savings companies at its disposal ... local savings associations, 34 regional savings banks, National Bank of the savings banks) Tripartite (519 local savings banks, 12 regional state banks, DekaBankDeutsche Girozentrale) Coordinating ... the reform of 1999 is transferable to these countries and can act as a model for them Comparing the structural features of French and German savings banks Structural feature France Germany Proprietor...
- 6
- 436
- 0
Báo cáo khoa học: "A Structured Model for Joint Learning of Argument Roles and Predicate Senses" pot
... Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ , Jan Stˇ p´ nek, Pavel Straˇ ... Role-less Argument Bias Problem For learning of the model, we borrow a fundamental idea of Kazama and Torisawa’s perceptron learning algorithm However, we use a more sophisticated online-learning algorithm ... plausible set of assignments of a predicate sense and its argument roles simultaneously We present an exact inference algorithm for the model, and a large-margin learning algorithm that can handle...
- 5
- 354
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... health such as alanine transaminase (ALT) and aspartate transaminase (AST) function increased as the MARV disease progressed (Figure 2E–F) As shown by the total Page of 13 (page number not for ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to ... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants...
- 13
- 456
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... health such as alanine transaminase (ALT) and aspartate transaminase (AST) function increased as the MARV disease progressed (Figure 2E–F) As shown by the total Page of 13 (page number not for ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to ... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants...
- 13
- 431
- 0
Báo cáo hóa học: "Research Article A Markov Model for Dynamic Behavior of ToA-Based Ranging in Indoor Localization" ppt
... design and performance evaluation of tracking capabilities of the proposed algorithms for indoor localization The parameters of the Markov model are analytically derived from the results of the ... among different classes of ranging errors, back and forth, as it keeps moving Such spatial correlation and change of class can easily be modeled with Markov chains 4.1 Ranging states of the Markov ... Orleans, La, USA, March 2003 [40] N A Alsindi, B Alavi, and K Pahlavan, “Measurement and modeling of UWB TOA-based ranging in indoor multipath environments,” 2007, to appear in IEEE Transactions...
- 14
- 314
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25