a method to obtain the ligand bound state with unusual substrates
Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt
... -7.4) The unmeasured anionrelated base deficit was greater than the total base deficit; this was predominantly due to the alkalinising effect of hypoalbuminaemia (mean albumin effect on base deficit ... two parameters into a single measurement that contains both quantitative and qualitative information This study did not attempt to address the role of lactate, but merely sought to validate a method ... data collection, preliminary data analysis and co-wrote the first draft of the manuscript SMT conceived the study, performed data analysis and co-wrote the first draft of the manuscript AD participated...
- 7
- 325
- 0
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx
... to detect the ampicillin resistant gene are AmpF (5'-gataacactgcggccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3') The reactions were cycled either in a Perkin Elmer thermocycler (DNA Thermal ... (Sigma) was used as an enhancer The reaction was made up to 50 µl with water The primers used to detect HIV-1 LTR are NI2F (5'-cacacacaaggctgacttccct-3') and NI2R (5'gccactccccagtccgccc-3') The ... of the peak count reached by the culture (CT) The data was plotted onto a graph (Figure 4) The data in this table are not directly comparable to that shown in figure because the total numbers...
- 10
- 278
- 0
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems
... Furthermore, the channel gain is modeled as a log-normal random variable Therefore, in order to make the analysis theoretically tractable, certain simplifying assumptions are made The channel gain ... Niranjayan, A Nallanathan and B Kannan, “Exact Modeling of Multiple Access Interference and BER Derivation for TH-PPM UWB”, WCNC 2005, Accepted for publication [5] S Niranjayan, A Nallanathan and ... technologies to choose the right candidate for the purpose of implementation or standardization It is important to have theoretical tools to evaluate these performance measures accurately, especially the...
- 104
- 421
- 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
... H37Ra (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg ... exercises on the treadmill The software provided with this system (TreadScan) can analyze the video, and can determine various characteristic parameters that are related to the pathophysiological conditions ... Statistical Package for the Social Sciences software (SPSS Inc Chicago, IL, USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the...
- 7
- 569
- 0
SETTLEMENT OF CONPLAINTS AND DENOUNCEMENT A METHOD TO ENSURE LEGISLATION AND DISCIPLINE IN VIETNAMESE STATE ADMINISTRATIVE MANAGEMENT AT RESENT
... the state administrative apparatus Based on the concept of legislation, the State s administration management can be understood: Legislation in the State s administration management as part of the ... this law to agencies, organizations and individuals authorized to know about the violation of any law agency individuals any damage or threatened damage to the interests of the State and the rights ... the State s administration management have close ties with together If complaints and denunciations solving the legal and discipline in the State s administration management are guaranteed to...
- 28
- 374
- 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... propriety assets According to him, Brand loyalty has to with the level of devotion a consumer has to a brand Brand awareness has to with the ability of a potential buyer to identify a brand among a product ... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together...
- 88
- 986
- 8
Báo cáo y học: "An innovative method to evaluate the suture compliance in sealing the surgical wound lip"
... the remaining stain (if any) dried Such photos were then analyzed to measure the surface stain area using an image analysis system (IAS) We chose the above timing because we found by trial and error ... Meylan, France), the hardware and software of which have been described by Brugal and colleagues [13] This system is fitted with a standard axioplan microscope with an automated stage (Carl Zeiss; ... of each suture line were analyzed to measure the width of the scar using the IAS described earlier STATISTICAL ANALYSIS The unpaired two-tailed student t test was used to compare the means among...
- 7
- 602
- 0
Development of a method to measure consumer emotions associated with foods
... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... such as pizza, chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, ... variations and has been named the EsSense Profile In addition, a 9-point hedonic scale was incorporated into the ballot to evaluate overall acceptability of the product and provide an anchor to...
- 10
- 781
- 3
Tài liệu THE VALUE OF IMPROVED PUBLIC SERVICES: AN APPLICATION OF THE CHOICE EXPERIMENT METHOD TO ESTIMATE THE VALUE OF IMPROVED WASTEWATER TREATMENT INFRASTRUCTURE IN INDIA docx
... wastewater is treated with secondary treatment and the quality of the water discharged to the river is high They are willing to pay about half as much to increase the treatment capacity of the ... significant Treated wastewater quantity and quality are significant factors in the choice of a wastewater treatment programme, and ceteris paribus, these two attributes increase the probability that ... such as the quantity and quality of wastewater treated in the STP and the regeneration of the Wonderland Park Assuming that the relationship between utility and attributes is linear in the parameters...
- 40
- 472
- 1
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...
- 12
- 616
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways, ... cells, analogously with heat-induced plasma membrane fluidization, are indeed capable of activating HSP formation even at the growth temperature, without causing measurable protein denaturation We also ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant...
- 10
- 452
- 0
Money and happiness a guide to living the good life
... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial ... earned a substantial salary as a financial planner in Ohio When she was pregnant with her first child, Jill asked to go part-time after the baby was born The company agreed, but when the time came, ... years “My mother had the last laugh,” Deb says “She has had a fabulous retirement, she and her boyfriend ride around [Florida’s] intercoastal waterway on their yacht My father had health setbacks...
- 258
- 358
- 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx
... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a ... interface which is a gateway to information on adaptation practices worldwide – the Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations,...
- 49
- 557
- 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx
... passed to the venue manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the ... seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts are minimised ... helping to reduce the cost of running the event Event managers can refer the guide to potential venues to highlight the fact that these are the range and type of issues to be addressed in choosing the...
- 5
- 527
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical modelling) can be used in combination with MCA to arrive at the ʺbestʺ solution(s) in the ... periods water with the appropriate salinity rate can be taken in by the farmers. 3.2. Boundary conditions There are several boundary conditions that need to be mentioned related to the problems ... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ...
- 13
- 487
- 0
hacking vim a cookbook to get the most out of the latest vim editor
... Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali Chittar Shantanu Zagade About the ... such a way that the toolbar is just another menu with a special name Hence, adding an icon to the toolbar is just like adding an item to a menu In the case of a 'toolbar menu', you will be able to ... 1991 as a clone of the Unix editor vi for the Amiga platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor...
- 224
- 942
- 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot
... data, data analysis and interpretation, manuscript writing; CA: collection and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript ... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... participation in the installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection,...
- 6
- 426
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25